Anti-aging peptide composition and application thereof

An anti-aging and composition technology, applied in the field of small molecular peptides, can solve the problems of skin cell operation and difficulty in achieving the effect, and achieve the effect of repairing skin damage, no skin damage, whitening and anti-wrinkle effect

Active Publication Date: 2020-10-13
广州市乾相生物科技有限公司
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The present invention provides an anti-aging peptide composition and its application, which solves the problem that when multiple peptides are used together, it is easy to cause skin cell manipulation and it is difficult to achieve a good effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-aging peptide composition and application thereof
  • Anti-aging peptide composition and application thereof
  • Anti-aging peptide composition and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] This embodiment is the construction of recombinant plasmid

[0080] see figure 1 , the map of the vector plasmid pLentilox 3.7 and the map of the packaging plasmid pRSV-REV in the lentiviral vector system of this example.

[0081] The construction of the recombinant plasmid expressing Tetrapeptide, the recombinant plasmid expressing Hexapeptide-11, the recombinant plasmid expressing CopperTripeptide, the recombinant plasmid expressing Pentapeptide-18 and the recombinant plasmid expressing Glycine max, the specific steps are as follows:

[0082] Tetrapeptide plus proline modified Lys-Glu-Lys to stabilize the peptide structure, the design sequence is (with the sequence shown in SEQ ID NO: 1):

[0083] ggagcccagcatggccgggcgggctcgccgcgccgcgcgtcccggggggcctcggcgcttctcgctgccgcgcttctctacgccgcgctgggggacgtggtgcgctcggagcagcagataccgctctccgtgtaagtgccggggctcctgcgccgcccggggggggggaccttgcagcctccgcgaccagtgtg

[0084] Hexapeptide-11 sequence Phe-Val-Ala-Pro-Phe-Pro, the design sequence is...

Embodiment 2

[0113] This embodiment is a screening method for the use ratio of peptide compositions

[0114] 1. The construction of hair follicle dermal papilla stem cells expressing Tetrapeptide PKEK, Copper Tripeptide, Pentapeptide-18, Glycine max and Hexapeptide-11, the specific steps are as follows:

[0115] Plasmid purification and cell culture

[0116] 1.1 Prepare the five sets of plasmids constructed in Example 1.

[0117] 1.2. 18-24 hours before transfection, put 2.5×10 6 293T cells were placed in a 10 cm dish and incubated overnight at 37°C. Cells should reach 65%-70% confluence within 24 hours.

[0118] Transfected 293T cells

[0119] 1.3. Add transfer vector pLentilox 3.7 and packaging plasmid pRSV-REV to Opti-MEM, mix by pipetting thoroughly.

[0120] 1.4. Add the transfection reagent to the same tube and vortex for 10 seconds.

[0121] 1.5. Incubate the mixture at room temperature for 15 minutes.

[0122] 1.6. Add the mixture dropwise to the Petri dish and vortex to dis...

Embodiment 3

[0143] This example is the preparation of Tetrapeptide PKEK, Copper Tripeptide, Pentapeptide-18 and Glycine max

[0144] see Figure 12 , a flowchart of the method for fermentation and purification of genetically engineered bacteria, the specific steps are as follows:

[0145] The four target genes of Tetrapeptide PKEK, Copper Tripeptide, Pentapeptide-18 and Glycine max screened in Example 2 were introduced into the plasmid. The plasmids and plasmid construction and verification methods selected in this example are the same as those in Example 1.

[0146] Select Escherichia coli as the engineering bacteria, respectively introduce the plasmids carrying the four target genes of Tetrapeptide PKEK, Copper Tripeptide, Pentapeptide-18, and Glycine max into Escherichia coli, and the plasmids contain tetracycline antibody fragments, and put the strains on the tetracycline medium Cultivate and screen out the strains that successfully introduced and expressed the tetracycline antibody...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of small molecule peptides, in particular to an anti-aging peptide composition and an application thereof. The invention discloses a peptide composition which is composed of tetrapeptide, hexapeptide-11, copper tripeptide, pentapeptide-18 and soybean polypeptide, wherein the mass ratio of the tetrapeptide to the copper tripeptide to the pentapeptide-18to the soybean polypeptide to the hexapeptide-11 is (5 to 5.5) to (3.2 to 4) to (6.8 to 8.3) to (9.3 to 10) to (0 to 0.3). All the components in the peptide composition cooperate with one another according to a proper mass ratio, and when the peptide composition is applied to skin, skin damage can be effectively repaired, the whitening and anti-wrinkle effects are good, secondary damage to the skin is avoided, and compared with other proportions, the anti-aging effect of the peptide composition is remarkable.

Description

technical field [0001] The invention relates to the technical field of small molecular peptides, in particular to an anti-aging peptide composition and its application. Background technique [0002] At present, there are many anti-aging products on the market, especially peptide cosmetics. Because active peptides have various physiological functions such as anti-oxidation, anti-aging, and scavenging free radicals, they have been widely used in cosmetics and other fields. However, at present, when a variety of peptides are used together, it is easy to cause skin cell damage, and it is difficult to achieve a good effect. Contents of the invention [0003] The invention provides an anti-aging peptide composition and its application, which solves the current problem that when multiple peptides are used together, it is easy to cause skin cell manipulation and it is difficult to achieve a good effect. [0004] Its specific technical scheme is as follows: [0005] The invention...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A61K8/64A61K8/34A61K8/49A61K8/67A61K8/44A61K8/86A61Q19/08A61Q19/02A61Q19/10A61Q19/00C07K5/08C07K5/117C07K7/06
CPCA61K8/64A61K8/645A61K8/345A61K8/4946A61K8/675A61K8/676A61K8/442A61K8/86A61Q19/08A61Q19/02A61Q19/10A61Q19/005C07K5/1024C07K7/06C07K5/08A61K2800/592A61K2800/5922A61K2800/522
Inventor 张志乾
Owner 广州市乾相生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap