Fusion protein and use thereof

A fusion protein and protein technology, applied in the field of fusion proteins, can solve the problems of large molecular weight and complex structure of the Fc segment, and achieve the effects of simple preparation method, good safety and reduced risk

Active Publication Date: 2020-10-30
SUPERMAB (BEIJING) BIOTECH CO LTD
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although it has been found that transpeptidase A can directly link various molecules (such as biotin, polypeptides, antibody heavy chain variable region VHH fragments) to the cell surface (US20160122707A1; Jeong HJ, et al., Generation of Ca2+-independent sortase A Mutants with enhanced activity for protein and cell surface labeling. PLoS One. 2017Dec 4; 12(12):e0189068; Chen I, et al., A general strategy for the evolution of bond-forming enzymes using yeast display. Proc Natl Acad Sci U S A .2011Jul 12; 108(28):11399-404.), however, due to the large molecular weight and complex structure of the Fc segment, there is no research report that can successfully pass the transpeptidase A to contain the Fc segment (fragment crystallizable region ) whole antibody or Fc fusion protein directly attached to the cell surface

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein and use thereof
  • Fusion protein and use thereof
  • Fusion protein and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Example 1: Expression and purification of transpeptidase A protein

[0077] 1. Construction of recombinant expression plasmid pET-SrtA

[0078] 1. The gene sequence of transpeptidase A is shown in sequence 1, and primer F is designed and synthesized according to sequence 1: 5'-CGGCAGC CATA TG GCTAAACCTCAAATTCCGA-3' (the underline is the restriction endonuclease NdeI digestion recognition sequence, sequence 35) and primer R: 5'-GTGGTG CTCGAG TTATTTGACTTCTGTAGCTAC-3' (underlined is the recognition sequence for restriction endonuclease XhoI, sequence 36).

[0079] Sequence 1:

[0080] ATGGCTAAACCTCAAATTCCGAAAGATAAATCGAAAGTGGCAGGCTATATTGAAATTCCAGATGCTGATATTAAAGAACCAGTATATCCAGGACCAGCAACAAGCGAACAATTAAATAGAGGTGTAAGCTTTGCAGAAGAAAATGAATCACTAGATGATCAAAATATTTCAATTGCAGGACACACTTTCATTGACCGTCCGAACTATCAATTTACAAATCTTAAAGCAGCCAAAAAAGGTAGTATGGTGTACTTTAAAGTTGGTAATGAAACACGTAAGTATAAAATGACAAGTATAAGAAACGTTAAGCCTACAGATGTAGGAGTTCTAGATGAACAAAAAGGTAAAGATAAACAATTAACATTAATTACTTGTGATGATTACAAT...

Embodiment 2

[0096]Example 2: Preparation and binding activity identification of fusion protein containing Fc segment

[0097] 1. Preparation of fusion protein containing Fc segment

[0098] 1. Construction of fusion protein particles containing Fc segment

[0099] For the structure of fusion proteins containing Fc segments (including recombinant antibodies and Fc fusion proteins, number: RP1-RP14), see figure 1 . The construction of the fusion protein expression plasmid is as described in Example 1. That is, using the cloning technique described in Example 1, the synthesized nucleic acid was cloned with primers containing HindIII and XhoI restriction sites, and the synthesized sequence was ligated to the vector pCDNA3.1(+) digested with the corresponding enzymes.

[0100] 1.1. Construction of the expression plasmid of recombinant antibody Ab-CH-LPETGG (numbering: RP1):

[0101] The DNA molecule shown in Sequence 3 is used to replace the fragment between the HindIII and XhoI rest...

Embodiment 3

[0224] Example 3 Using transpeptidase A to link a fusion protein containing an Fc segment to NK92-FcγRIII cells and detection of cell activity

[0225] 1. Use transpeptidase A to link the fusion protein containing the Fc segment to NK92-FcγRIII cells (purchased from ATCC, Item No.: pta-8837)

[0226] 1. Take 100 μL of the concentration of 1.0x10 6 / mL of NK92-FcγRIII cell suspension, add transpeptidase A to a final concentration of 20ug / ml, and add a fusion protein containing an Fc segment to a final concentration of 10ug / ml to obtain an incubation system. The incubation system was incubated at 25° C. for 90 min. Centrifuge, collect the cells, and wash thoroughly with pH 7.4, 0.01mol / L PBS buffer. The cells obtained above were named: recombinant protein-SrtA-NK.

[0227] 2. Take 100 μL of the concentration of 1.0x10 6 / mL of NK92-FcγRIII cell suspension, only the fusion protein containing the Fc segment was added to a final concentration of 10ug / ml to obtain an incubat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fusion protein and use thereof. The fusion protein comprises, from N to C terminals, a first moiety, an Fc segment, a linker moiety comprising a moiety selected from the group consisting of a linker and a protein or polypeptide selected from the group consisting of IL2 or scFv, and a substrate moiety of transpeptidase A; the linker comprises a sequence selected from thegroup consisting of (1) (GGGGS) n, wherein when the linker moiety comprises the protein or polypeptide and linker, n>=1; when the linker moiety only comprises the joint, n>=3; and (2) (EAAK) n, n >= 1; the substrate moiety comprises a sequence as shown in LPXTG. The fusion protein can be directly connected to cells to enable the cells to have targeting property, is simpler than an existing methodfor preparing targeting cells through cell transfection, and can also reduce the risk possibly generated by effector cell genome operation at the same time.

Description

technical field [0001] The present invention relates to the field of proteins, in particular fusion proteins suitable for linking antibody Fc regions to cells. Background technique [0002] Cell therapy is a new technology for disease treatment that has emerged in recent years. It refers to the use of the characteristics of certain cells with specific functions (such as stem cells and immune cells), and the cells with enhanced functions produced after specific treatment, and then infused into the body to treat diseases. the goal of. With the continuous development of stem cell therapy, immune cell therapy and gene editing and other basic theories, technical means and clinical medical exploration research, cell therapy products provide new treatment ideas and methods for some serious and refractory diseases, showing more and more The higher the application value. [0003] Targeted therapy is a drug therapy that treats diseases by interfering with specific molecules. Targete...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62A61K35/17A61K47/68A61P35/00A61P37/02A61P31/00
CPCC07K14/705A61K35/17A61K47/68A61P35/00A61P37/02A61P31/00C07K2319/30C07K14/55C07K7/06C07K14/7155C07K2317/622C07K2317/52C07K16/28A61K39/4633A61K39/4635A61K39/4613A61K39/4611C07K16/00
Inventor刘玉
OwnerSUPERMAB (BEIJING) BIOTECH CO LTD