Application of CCDC157 gene and mutant gene thereof as molecular markers in diagnosis of male infertility diseases
A technology of CCDC157, 1.CCDC157-MIF515, applied in sexual diseases, medical preparations containing active ingredients, disease diagnosis, etc., can solve problems such as unclear biological functions and related molecular mechanisms
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Gene mutation screening in patients CCDC157-MIF515 1 asthenospermia patients embodiment and embodiment thereof semen analysis
[0027] 1) The study was approved by the Ethics Committee of Obstetrics and Gynecology Hospital, Zhejiang University School of Medicine, and after informed consent of patients. Collect weak sperm in the semen of patients of Obstetrics and Gynecology Hospital, Zhejiang University School of Medicine, 50 cases, and the exclusion of patients with organic disease of the reproductive system, endocrine disorders untreated patients, within two years of drug or alcohol abuse, chromosome, AZF abnormalities semen abnormalities such as a patient, cryptorchidism, mumps known cause or a result.
[0028] Asthenozoospermia patient masturbation sperm, extracted using TIANamp Micro DNA Kit patient sperm DNA (according to the sixth specification - trace genomic DNA was extracted from the tissue).
[0029] For two conserved functional domains --SMC CCDC157 domain (i.e....
Embodiment 2
[0040] Example 2, CCDC157 knock-out mice is obtained
[0041] 1) the use of CRISPR / Cas9 technology, two sgRNA for CCDC157 gene sequence (numbered in the NCBI database is 216516) design by CRISPR online website (http: / / crispr.mit.edu), such as design strategy figure 2 As shown in A, gRNA1 (SEQ ID NO.12): CTCTGAGAGCGGCCTATGGTGGG; gRNA2 (SEQ ID NO.13): GGGAGGATCCATCCAACCTAGGG (2 th gRNA both genes matched the antisense strand). After synthesis, annealing linked to an expression vector Cas9 pX458 protein.
[0042] 2) The pX458 vector into an embryonic stem cell, by screening the flow proceeds dish for 24 hours. Monoclonal picked and genotyping After completing the culture.
[0043] 3) in advance of superovulated C57BL / 6N female mice mated to wild type male hormones by the process to obtain a large number of cells in blastocysts (ligated simultaneously to mate with male mice and C57BL / 6N female mice produce false foster mothers) , filtered out in the previous step with a genetica...
Embodiment 3
[0060] Example 3 CCDC157 knock embodiment except cause infertility in male mice
[0061] 1) observe and count CCDC157 - / - Mice and CCDC157 + / + Growth and development of the mice. The results show that CCDC157 - / - Mice CCDC157 + / + Mice survival, appearance (e.g. figure 2 No difference) and the overall behavior shown in F.; Male CCDC157 - / - Mice completely sterile, female CCDC157 - / -Mice fertility was not affected. The above results show, CCDC157 knockout mice results in male sterility.
[0062] 2) Take three male CCDC157 - / - Mouse, and a number of female wild-type mice were mated three months. During mating observe whether the reproductive tract of female wild type mice presence of fine plug. As a result, the presence of fine pin female genital tract wild type mice, indicating that mate with; birth, but no offspring.
[0063] These results indicate that CCDC157 knockout affect the fertilization process.
[0064] 3) observe CCDC157 - / - Mouse gonads; as follows: to take the growth of...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


