Supercharge Your Innovation With Domain-Expert AI Agents!

Application of CCDC157 gene and mutant gene thereof as molecular markers in diagnosis of male infertility diseases

A technology of CCDC157, 1.CCDC157-MIF515, applied in sexual diseases, medical preparations containing active ingredients, disease diagnosis, etc., can solve problems such as unclear biological functions and related molecular mechanisms

Active Publication Date: 2020-11-10
ZHEJIANG UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CCDC157 has only been reported to be an important factor in the fusion of the transport carrier and the Golgi apparatus, but its biological function and related molecular mechanism are still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of CCDC157 gene and mutant gene thereof as molecular markers in diagnosis of male infertility diseases
  • Application of CCDC157 gene and mutant gene thereof as molecular markers in diagnosis of male infertility diseases
  • Application of CCDC157 gene and mutant gene thereof as molecular markers in diagnosis of male infertility diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Gene mutation screening in patients CCDC157-MIF515 1 asthenospermia patients embodiment and embodiment thereof semen analysis

[0027] 1) The study was approved by the Ethics Committee of Obstetrics and Gynecology Hospital, Zhejiang University School of Medicine, and after informed consent of patients. Collect weak sperm in the semen of patients of Obstetrics and Gynecology Hospital, Zhejiang University School of Medicine, 50 cases, and the exclusion of patients with organic disease of the reproductive system, endocrine disorders untreated patients, within two years of drug or alcohol abuse, chromosome, AZF abnormalities semen abnormalities such as a patient, cryptorchidism, mumps known cause or a result.

[0028] Asthenozoospermia patient masturbation sperm, extracted using TIANamp Micro DNA Kit patient sperm DNA (according to the sixth specification - trace genomic DNA was extracted from the tissue).

[0029] For two conserved functional domains --SMC CCDC157 domain (i.e....

Embodiment 2

[0040] Example 2, CCDC157 knock-out mice is obtained

[0041] 1) the use of CRISPR / Cas9 technology, two sgRNA for CCDC157 gene sequence (numbered in the NCBI database is 216516) design by CRISPR online website (http: / / crispr.mit.edu), such as design strategy figure 2 As shown in A, gRNA1 (SEQ ID NO.12): CTCTGAGAGCGGCCTATGGTGGG; gRNA2 (SEQ ID NO.13): GGGAGGATCCATCCAACCTAGGG (2 th gRNA both genes matched the antisense strand). After synthesis, annealing linked to an expression vector Cas9 pX458 protein.

[0042] 2) The pX458 vector into an embryonic stem cell, by screening the flow proceeds dish for 24 hours. Monoclonal picked and genotyping After completing the culture.

[0043] 3) in advance of superovulated C57BL / 6N female mice mated to wild type male hormones by the process to obtain a large number of cells in blastocysts (ligated simultaneously to mate with male mice and C57BL / 6N female mice produce false foster mothers) , filtered out in the previous step with a genetica...

Embodiment 3

[0060] Example 3 CCDC157 knock embodiment except cause infertility in male mice

[0061] 1) observe and count CCDC157 - / - Mice and CCDC157 + / + Growth and development of the mice. The results show that CCDC157 - / - Mice CCDC157 + / + Mice survival, appearance (e.g. figure 2 No difference) and the overall behavior shown in F.; Male CCDC157 - / - Mice completely sterile, female CCDC157 - / -Mice fertility was not affected. The above results show, CCDC157 knockout mice results in male sterility.

[0062] 2) Take three male CCDC157 - / - Mouse, and a number of female wild-type mice were mated three months. During mating observe whether the reproductive tract of female wild type mice presence of fine plug. As a result, the presence of fine pin female genital tract wild type mice, indicating that mate with; birth, but no offspring.

[0063] These results indicate that CCDC157 knockout affect the fertilization process.

[0064] 3) observe CCDC157 - / - Mouse gonads; as follows: to take the growth of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a CCDC157 gene and a mutant gene thereof as molecular markers in diagnosis of male infertility diseases. Experiments show that the CCDC157-MIF515 mutant gene / protein causes male infertility, spermatogenesis disorder, sperm dysfunction, sperm quantity reduction, sperm motility reduction, sperm morphological abnormality, sperm head deformity and the like. The CCDC157-MIF515 mutant gene / protein disclosed by the invention can be used as a target gene for diagnosing male infertility. Meanwhile, CCDC157 expression level of the CCDC157 gene / protein is remarkablyreduced in NOA patients and SCOS patients, and the male infertility can be prevented and / or treated by improving activity and / or expression quantity of the CCDC157 protein.

Description

Technical field [0001] The present invention is in the field of biomedicine and, more particularly, is in the field of diagnosis of mutations, particularly relates to a diagnostic CCDC157 mutated nucleotide sequence or an amino acid sequence lead to male infertility kit. Background technique [0002] About 15% of the world's couples have infertility problems, in which male factors accounted for 50%, and year by year growth trend, male infertility has brought a heavy burden on individuals, families and society. Resulting in a complicated male infertility causes, including the anatomy and function of the reproductive system factors, infectious factors, endocrine immune factors, genetic factors, psychological factors and so on. Spermatogenesis disorder caused by genetic defects account for about 10% -15% of male infertility, the major clinical manifestations of oligoasthenoteratozoospermia sperm (OAT) or no sperm (azoospermia). Part oligoasthenozoospermia Azoospermia and can be obta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883G01N33/68A61K45/00A61P15/08
CPCC12Q1/6883G01N33/6893A61K45/00A61P15/08C12Q2600/156G01N2800/367G01N2333/47G01N33/689G01N33/6818
Inventor 席咏梅郑慧梅李晨杨小杭李景平张峰彬梁忠炎吴敬根苑鑫侯佳汝朱鑫海邓寰
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More