H1N1 influenza virus detection method and kit thereof

A detection kit and influenza virus technology, applied in the field of biological analysis, can solve the problems of inability to detect H1N1 virus, poor reproducibility and anti-interference ability of electrochemical sensors, etc., achieve high reproducibility, low detection cost, reduce cost effect

Active Publication Date: 2020-12-11
CAPITAL NORMAL UNIVERSITY
View PDF7 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the reproducibility and anti-interference ability of electrochemical sensors based on nucleic acid aptamers are poor, and the detection of H1N1 virus in actual clinical samples of throat swabs cannot be realized.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • H1N1 influenza virus detection method and kit thereof
  • H1N1 influenza virus detection method and kit thereof
  • H1N1 influenza virus detection method and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1. The present invention detects the method for H1N1 influenza virus based on qPCR technology

[0044] The sequence of the DNA aptamer P-A8S used in all the following examples is: 5'-GCAATGGTACGGTACTTCCATTCGACCTCTGTAACAGCCACGAAAACCCTATATC AAAAGTGCACGCTACTTTGCTAA-3'.

[0045] Such as figure 1 As shown, the present embodiment includes the following specific experimental steps:

[0046] 1) Activated magnetic beads

[0047] ① Mix the magnetic beads: place the carboxyl-coated magnetic beads on a rotary mixer, and mix at 7 revolutions per minute (rpm) for 15 minutes (min).

[0048] ② Cleaning of magnetic beads: Take 10 microliters (μL) of the above mixed magnetic beads in a 1.5 milliliter (ml) centrifuge tube, add 50 μL of 2-morpholineethanesulfonic acid (MES) buffer to wash, rotate at room temperature at 7 rpm, and mix thoroughly After 10 min, magnetic separation was performed, and the supernatant was discarded. A total of 3 washes.

[0049] ③ Activated magne...

Embodiment 2

[0057] Example 2. Verification of the feasibility of H1N1 virus detection based on qPCR method: detection and selectivity test of high-concentration H1N1 virus

[0058] This example is carried out according to the steps in Example 1, but 3) blocking is not carried out, and step 4) uses different incubation conditions: different concentrations of H1N1 or H5N1 influenza virus (1mg / L, 100μg / L, 10μg / L L), after incubating with the activated magnetic beads at room temperature at 6 rpm for 2 h, the centrifuge tube was placed in a refrigerator at 4° C. for further incubation for 12 h.

[0059] the result shows( figure 2 ), according to the method shown in Example 1 of the present invention, the H1N1 influenza virus of 1 mg / L can be specifically detected, and the number of nucleic acid aptamers combined with H1N1 is greater than that of blank and H5N1 at the same concentration. The experiment found that the blank was very high, and the coupling of H5N1 on the surface of magnetic bea...

Embodiment 3

[0060] Example 3. Optimizing the sealing conditions of the magnetic bead interface

[0061] In order to reduce the non-specific adsorption of nucleic acid aptamers on the interface and reduce the detection limit, we optimized the interface blocking conditions of magnetic beads. In addition to yeast tRNA and salmon sperm DNA, we added 0.1% Tween 80 to the blocking agent. The whole detection process is carried out according to the steps shown in Example 1. image 3 As shown, the combination of blocking agent and Tween80 can significantly reduce the non-specific adsorption of nucleic acid aptamers on the interface.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an H1N1 influenza virus detection method and a kit thereof. According to the invention, a simple and rapid chemical coupling method is utilized to realize efficient capture ofan inactivated complete H1N1 influenza virus; and a DNA aptamer capable of specifically recognizing the inactivated A-type H1N1 virus is used as a recognition probe to achieve specific recognition ofthe virus, and finally quantitative detection of the inactivated complete H1N1 influenza virus is achieved through real-time quantitative PCR. A detection limit is 1ng / L, and the kit has no responseto other viruses and has good specificity. Colorimetric detection of the H1N1 virus can be achieved by combining with nanogold, and the detection limit is 1 ng / L. According to the method, the completeinactivated virus serves as a target, the low-cost DNA aptamer serves as a recognition molecule, and advantages of good safety and low cost are possessed. Moreover, the method and the kit are high insensitivity and good in specificity, are successfully used for detecting the H1N1 in a throat swab sample, and have a very good clinical application value.

Description

technical field [0001] The invention relates to a low-cost and high-safety detection method for influenza virus based on a DNA nucleic acid aptamer and a kit thereof, belonging to the technical field of biological analysis. Background technique [0002] H1N1 influenza virus belongs to influenza A virus, which is a highly contagious human pathogen. Influenza A virus has very frequent antigenic drift and antigenic switching, which makes it difficult to develop anti-influenza virus specific drugs, vaccines or diagnostic methods. In order to protect public health and reduce the outbreak of infectious diseases, there is an urgent need for high-safety, low-cost, and highly sensitive detection methods that can be used for rapid detection of H1N1 influenza virus. [0003] Existing virus detection methods can be divided into two categories: genetic detection methods and antibody detection methods. Genetic testing uses the polymerase chain reaction (PCR) to detect the DNA or RNA gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569
CPCG01N33/56983
Inventor娄新徽潘雅杰陆张伟
OwnerCAPITAL NORMAL UNIVERSITY