Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant aviadenovirus type 4 fiber2 protein as well as preparation method and application thereof

A poultry adenovirus and recombinant protein technology, applied in the field of genetic engineering, can solve the problems of uncontrollable product quality, poor immune effect, and poor immunogenicity, and achieve the effects of controllable quality, improved solubility, and improved immunogenicity

Active Publication Date: 2020-12-29
YANGTZE UNIVERSITY +1
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing technologies such as patent CN108918869A disclose the application of fiber2 protein and its recombinant protein in the detection of serum type 4 avian adenovirus antibodies, but the unmodified fiber2 protein is expressed as an insoluble protein by prokaryotic cells, and it is difficult to make it directly Vaccine, and the product quality is uncontrollable, the immunogenicity is relatively poor, resulting in poor immune effect, and there is still a risk of infection after use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant aviadenovirus type 4 fiber2 protein as well as preparation method and application thereof
  • Recombinant aviadenovirus type 4 fiber2 protein as well as preparation method and application thereof
  • Recombinant aviadenovirus type 4 fiber2 protein as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1 Preparation of recombinant adenovirus type 4 fiber2 protein

[0026] 1. Cloning and sequencing of FAdV-4fiber2 protein coding gene

[0027] Extract total DNA from chicken liver tissue infected with FAdV serotype 4, use Fiber 2PF / Fiber 2PR primers (SEQ ID NO.17-18), and use total DNA as a template to amplify the fiber2 gene by PCR. The length of the gene is 1440bp .

[0028] The primer sequences used to amplify the fiber2 gene are as follows:

[0029] Fiber 2PF: GAGCTC ATGCTCCGGGCCCCTAAAAGAAGAC

[0030] Fiber 2PR: AAGCTT TTACGGGAGGGAGGCCGCTGGACAGCT

[0031] (The underlined part in Fiber 2PF is the cutting site of SacI restriction endonuclease, and the underlined part in Fiber 2PR is the cutting site of HindⅢ restriction endonuclease)

[0032] The amplification system (20μL) is:

[0033]

[0034] After the PCR, the target gene fragment was recovered by agarose gel electrophoresis, and then TA cloning was performed, and the TA cloning system was sp...

Embodiment 2

[0073] Example 2 E.coli BL21(DE3) / pET28a FAdV Nd274 fiber2 M3 expression protein detection analysis and purification

[0074] 1. Detection and analysis of expressed protein

[0075] The expression engineered strain E.coli BL21(DE3) / pET28a FAdV Nd274 fiber2 M3 was induced to express. The inducer is α-lactose, and the working concentration is: 0.03mol / L. After ultrasonic centrifugation, the expression level and dissolution status of the target protein in the bacteriostasis solution before and after centrifugation were detected by SDS-PAGE electrophoresis.

[0076] The results of SDS-PAGE electrophoresis detection of the engineered bacteria E.coli BL21(DE3) / pET28a FAdV Nd274 fiber2 M3 are shown in the attached figure 2 Shown, where lane 1 is the blank control E.coli BL21(DE3) / pET28a without the target fragment, and lane 2 is Marker (14, 25, 30, 40, 50, 70, 100, 120kDa respectively from small to large ), lane 3 is the whole bacterial solution of FAdV Nd274 fiber2 M3 expressing...

Embodiment 3

[0085] Example 3 Preparation of FAdV-4 Genetic Engineering Subunit Vaccine and Immune Challenge Experiment

[0086] 1. Vaccine preparation

[0087] After the FAdV 4Nd274 fiber2 M3 purified protein obtained in Example 2 was treated with endotoxin, it was diluted with PBS solution to contain the target protein at 100 μg / ml. According to the ratio of protein solution:vaccine adjuvant=1:3 (W / W), the vaccine adjuvant MONTANIDEIM ISA 71VG was added to prepare the finished vaccine for subsequent immune challenge experiments, wherein the target protein content was 25 μg / ml.

[0088] 2. Grouping and immunization of experimental chickens

[0089] Choose 2 weeks old SPF chicken, be divided into 6 groups altogether, every group 8, the processing mode of every group is as follows:

[0090] 1. Experimental group 1: 0.1 mL of the above-mentioned finished vaccine was immunized once (2.5 micrograms of protein per animal), and the virus was challenged 28 days after immunization;

[0091] 2. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant fowl adenovirus type 4 (FAdV-4) fiber2 protein as well as a preparation method and application thereof, and belongs to the technical field of gene engineering. The recombinant protein is obtained by removing 274 amino acid residues at the N end of the fowl adenovirus type 4 fiber2 protein and then recombining with the 21-55th amino acid sequence of the fowl adenovirus type 4 hexon protein; and can be used for preparing the avian adenovirus 4-type genetic engineering subunit vaccine. Aiming at the defects of poor solubility and immunogenicity of prokaryoticexpression natural fiber2 protein, the fiber2 protein coding gene is subjected to series modification, and compared with the unmodified fiber2 protein, the recombinant protein has the advantages thatthe gene coding sequence of 274 amino acid residues at the N end of the fiber2 protein is removed, and the gene coding sequences of two important antigen epitopes of the hexon protein are fused; so that the solubility and the immunogenicity are obviously improved, so that the subunit vaccine which is controllable in quality, safe and effective and can prevent highly pathogenic FAdV-4 virus infection can be prepared, and complete protection can be obtained by once immunization.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a recombinant adenovirus type 4 fiber2 protein of avian adenovirus and its preparation method and application. Background technique [0002] Avian adenovirus (FAdV) belongs to the family Adenoviridae and is divided into three groups according to the group-specific antigens: group I, group II, and group III. Among them, group I adenovirus has five genera (FAdV- A, B, C, D, E) and 12 serotypes (FAdV-1, 2, 3, 4, 5, 6, 7, 8a, 8b, 9, 10, 11). They share a common group antigen. Avian adenovirus serotype 4 (FAdV-4) is the causative agent of pericardial effusion syndrome (HHS). The disease is one of the major infectious diseases of the poultry industry and is characterized by pericardial effusion and inclusion body hepatitis. Avian adenovirus infection first occurred in the United States in 1963, and then spread to all parts of the world. FAdV infection genera...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/075C12N15/34C12N15/70C12N1/21A61K39/235A61P31/20
CPCC07K14/005C12N15/70A61K39/12A61P31/20C12N2710/10222C12N2710/10234A61K2039/552
Inventor 荣俊胡基雄李国攀王席匡红艳
Owner YANGTZE UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com