Check patentability & draft patents in minutes with Patsnap Eureka AI!

CAR-T cell for expressing immune regulation factors and application thereof

An immune regulation and cell technology, applied in the field of biomedicine, can solve the problems such as the inability of peripheral blood immune cells to be recruited into the tumor and the inability to secrete exogenous IL-7 protein, so as to improve the anti-tumor efficiency and enhance the effect of tumor inhibition.

Pending Publication Date: 2021-01-12
汤朝阳
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] CN109504660A discloses a fourth-generation CAR-T cell and its construction method and application. The CAR includes an extracellular antigen binding region, a hinge region, an intracellular signal transduction region, and a cytokine signal region, wherein the extracellular antigen The binding region targets the two spatial epitopes of the Nectin-4 antigen, and the cytokine signaling region is IL7 and CCL19, but exogenous IL-7 protein cannot be secreted outside T cells, and the continuous secretion of CCL19 cannot maximize the Problems with peripheral blood immune cell recruitment into tumor interiors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CAR-T cell for expressing immune regulation factors and application thereof
  • CAR-T cell for expressing immune regulation factors and application thereof
  • CAR-T cell for expressing immune regulation factors and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] The preparation of embodiment 1 lentiviral vector

[0059] Whole-gene synthesis of the following nucleic acid molecules:

[0060] ① A CAR molecule formed in series by the nucleic acid sequences of CD8α signal peptide, anti-GPC3 single-chain antibody, CD8α transmembrane domain, 4-1BB and CD3ζ (the amino acid sequence is shown in SEQ ID NO: 4);

[0061] ② IL-7 signal peptide (SEQ ID NO: 9) and IL-7 (without IL-7 signal peptide) (SEQ ID NO: 6), 2A peptide (SEQ ID NO: 10) and CCL19 (SEQ ID NO :8) the nucleic acid molecules formed in series by the nucleic acid sequences;

[0062] ③ A secreted IL-7 molecule formed by tandem nucleic acid sequences of IFN-γ signal peptide (SEQ ID NO:5) and IL-7 (without IL-7 signal peptide) (SEQ ID NO:6);

[0063] ④ A conditional CCL19 molecule formed by tandem 5×NFAT-RE-IL-2 promoter (SEQ ID NO:7) and CCL19 (SEQ ID NO:8);

[0064] SEQ ID NO: 9:

[0065] atgttccatgtttcttttaggtatatctttggacttcctcccctgatccttgttctgttgccagtagcatcatct;

[0066] ...

Embodiment 2

[0069] Example 2 Recombinant lentiviral packaging

[0070] In this example, 293T cells were used to prepare recombinant lentiviruses, and when the 293T cells spread to 80-90% of the bottom of a 100mm culture dish, the lentiviruses were packaged:

[0071] Cultivate 293T cells in a 10cm culture dish, the medium is DMEM high glucose medium + 10% FBS (fetal bovine serum) + 1% double antibody (100 × penicillin-streptomycin mixed solution); 293T cells in the culture dish When the density reaches 80%, replace the medium with DMEM high glucose medium + 1% FBS + 1% double antibody;

[0072] Prepare the plasmid mixture shown in Table 1, pWPXLd-expression plasmids include lentiviral vectors expressing CAR molecules, lentiviral vectors expressing complete IL-7 and CCL19, or lentiviral vectors expressing secreted IL-7 and conditional CCL19 carrier;

[0073] Table 1

[0074] Reagent dose pWPXLd-expression plasmid 4.5μg pMD2.G 1.5μg psPAX2 6μg

[0075...

Embodiment 3

[0081] Example 3 Preparation of CAR-T cells expressing IL-7 and CCL19

[0082] (1) Peripheral blood mononuclear cells (PBMC) were separated from whole blood by Ficoll density gradient centrifugation kit (GE Company), and after red blood cells were removed, T cells were sorted by MACS Pan-T magnetic beads; the sorted T cells were diluted with medium (AIM-V medium + 5% FBS + penicillin 100 U / mL + streptomycin 0.1 mg / mL) to a cell concentration of 2.5×10 6 pcs / mL for use;

[0083] (2) Add 10 μL of Miltenyi TransAct T cell reagent to each ml of cell suspension, and replace it with fresh medium (IMDM medium + 5% FBS (fetal bovine serum) + 1% double antibody (100× penicillin-streptomycin mixed solution)+IL-2);

[0084] (3) will 3×10 7 The activated T cells were centrifuged at 300g for 5min, and resuspended with 3mL medium (IMDM medium + 5% FBS (fetal bovine serum) + 1% double antibody (100 × penicillin-streptomycin mixed solution));

[0085] (4) Inoculate 3 mL of T cell suspensi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a CAR-T cell for expressing immune regulation factors and application thereof. The CAR-T cell expresses a chimeric antigen receptor specifically combined with an antigen, secretory IL-7 and conditional CCL19; a signal peptide of the IL-7 is an IFN-gamma signal peptide; and a promoter of the CCL19 is an NFAT regulation promoter. The CAR-T cell expresses the immune regulationfactors, namely the secretory IL-7 and the conditional CCL19, and the multiplication capacity of CAR-T is enhanced, so that the CAR-T recruits immune cells into tumors to the maximum extent, and the anti-tumor efficiency of the CAR-T cell is improved.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and relates to a CAR-T cell expressing an immune regulatory factor and an application thereof. Background technique [0002] Chimeric antigen receptor (CAR) is a chimeric protein obtained by fusing a single-chain antibody that recognizes a tumor antigen with a signal transduction region that induces T cell activation. Introduce a gene encoding CAR into T cells, so that CAR-T cells express CAR molecules that specifically recognize and bind tumor antigens on the membrane, and induce T cell activation in a manner independent of major histocompatibility gene complexes Specific killing of tumor cells. [0003] At present, CAR-T therapy has made great breakthroughs in leukemia, lymphoma and other hematopoietic malignancies, but it still has no good effect on the treatment of solid tumors. Researchers have improved and optimized CAR-T therapy to improve the therapeutic effect of CAR-T on solid tum...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/867C12N7/01C07K19/00A61K39/00A61P35/00
CPCC07K16/303C07K14/7051C07K14/5418C07K14/521C12N5/0636C12N15/86C12N7/00A61K39/00114A61K39/001142A61P35/00C07K2319/02C07K2319/03C07K2319/33C12N2510/00C12N2740/15021C12N2740/15043
Inventor 汤朝阳秦乐吴迪魏志辉王翠花王艳艳其他发明人请求不公开姓名
Owner 汤朝阳
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More