Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cinnamate-4-hydroxylase gene ThC4H and use thereof

A hydroxylase, cinnamic acid technology, applied in the field of genetic engineering, can solve problems such as relatively few studies at the molecular level

Active Publication Date: 2021-02-26
HANGZHOU SANYEQING AGRI TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research on Clover mainly focuses on cultivation, seedling cultivation, extraction and separation of chemical components and pharmacological effects, etc., and there are few studies on its molecular level.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cinnamate-4-hydroxylase gene ThC4H and use thereof
  • Cinnamate-4-hydroxylase gene ThC4H and use thereof
  • Cinnamate-4-hydroxylase gene ThC4H and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 3

[0025] Example 1 Acquisition of the full-length cDNA sequence of A. trifoliate ThC4H gene

[0026] The leaves of fresh plants of Clover were taken, wrapped in tin foil, and quickly frozen with liquid nitrogen, total RNA was extracted, and reverse transcribed into cDNA. Total RNA was extracted according to the instructions of TIANGEN RNAprep Pure Plant Total RNA Extraction Kit (DP441), and its integrity and concentration were detected by 1.0% agarose gel electrophoresis and a nucleic acid concentration detector.

[0027] Reverse transcription of total RNA according to Takara PrimeScript TM II 1st Strand cDNA Synthesis Kit instructions.

[0028] According to the BLAST analysis of the existing transcriptome data and the C4H gene sequence of the same family and genus in NCBI, the sequence with the highest similarity was selected as the target gene sequence, and several pairs of primers were designed with the open reading frame sequence of this sequence as a template. The amplif...

Embodiment 2

[0034] Example 2 Secondary structure and tertiary structure prediction and phylogenetic tree analysis of ThC4H

[0035] Using the online software SOPMA (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.pl?page=nps a_sopma.html) to predict the secondary structure of ThC4H protein in the resveratrol biosynthetic pathway, the results Such as figure 2 As shown, the protein is composed of 47.92% α-helix (Alpha helix), 12.87% extended chain (Extended strand), 4.55% β-turn (Beta turn) and 34.65% random coil (Random coil), It shows that the α-helical structure is the backbone of the secondary structure of protein C4H.

[0036]Use the online software SWISS-MODEL (http: / / swissmodel.expasy.org / ) to predict the three-dimensional structure of the ThC4H protein in the resveratrol biosynthetic pathway. The method used is X-ray, and the resolution is The result is as image 3 shown. The template number used is 6vby.1.A, the sequence identity (Seq Identity) is 75.25%, the state of the oli...

Embodiment 3

[0043] Functional verification of embodiment 3 ThC4H gene

[0044] The cDNA sequence of the ThC4H gene and the distribution of restriction sites on the plasmid vector pCMBIA1301 were analyzed, and PCR primers with SmaⅠ and XbaⅠ restriction sites were designed (upstream primer: TCCCCCGGGATGGATCTCATACTCATCG; downstream primer: GCTCTAGATCAAGCTTCTATTGGCTTTG) for the construction of overexpression vector.

[0045] Clover cDNA was used as a template for PCR amplification, and the reaction system was the same as above. After the amplified product was subjected to 1.0% agarose gel electrophoresis, a kit was used to purify and recover the DNA fragment consistent with the target gene. The purified recovered product and the plasmid pCMBIA1301 were subjected to double enzyme digestion at 37°C, followed by agarose gel electrophoresis and then purified and recovered. The digested products after purification and recovery were ligated with T4 DNA ligase and incubated overnight at 16°C. The l...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cinnamate-4-hydroxylase gene ThC4H derived from tetrastigma hemsleyanum and use of the cinnamate-4-hydroxylase gene ThC4H. The cinnamate-4-hydroxylase gene ThC4H has a nucleotide sequence shown as SEQ ID NO.1. The tetrastigma hemsleyanum is used as a biological source to design primers to amplify a cDNA sequence to obtain the cinnamate-4-hydroxylase gene ThC4H, and the gene is used as one of key enzymes in a phenylpropane metabolic pathway and can be used for producing resveratrol.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, and mainly relates to a cinnamic acid-4-hydroxylase gene ThC4H derived from cloverleaf and its application. Background technique [0002] In recent years, the country has attached great importance to traditional Chinese medicine and the government's strong support has driven the rapid development of the Chinese medicine industry and expanded the market demand for Tetrastigma hemsleyanum Diels et Gilg. The continuous deepening of research on the anti-tumor effect of cloverleaf has led to a rapid increase in the market price of cloverleaf in recent years, and its market demand is also increasing. [0003] In recent years, the gene regulation of the synthesis of medicinal plant secondary metabolites has become a very active frontier research field in molecular biology. The amount and composition of metabolites mainly depend on the key enzymes of biosynthesis and the expression levels in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N9/02C12N15/70C12N1/21C12P7/22C12R1/19
CPCC12N9/0073C12N15/70C12P7/22C12Y114/13011
Inventor 夏鹏国胡婉莹张宇杨东风章彩娟梁宗锁
Owner HANGZHOU SANYEQING AGRI TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com