Genetically engineered bacterium for strengthening nC14-surfactin component as well as construction method and application of genetically engineered bacterium

A technology of genetically engineered bacteria and recombinant bacteria, applied in the field of genetic engineering

Pending Publication Date: 2021-03-12
NANJING UNIV OF TECH
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006]Currently, strategies for modifying the structural components of surfactin have been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium for strengthening nC14-surfactin component as well as construction method and application of genetically engineered bacterium
  • Genetically engineered bacterium for strengthening nC14-surfactin component as well as construction method and application of genetically engineered bacterium
  • Genetically engineered bacterium for strengthening nC14-surfactin component as well as construction method and application of genetically engineered bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1 Construction of Bacillus subtilis BSFX024 and BSFX025 bacterial strains

[0064] Step 1: Construct the knockout targeting fragments △pps' and △pks' according to the reverse screening marker method. Based on the principle of homologous recombination, the targeting fragments pps' and pks' were constructed by the following primers, and the pps' fragment was transformed into the competent state of BSFX022 to obtain the recombinant strain BSFX023; then the pks gene knockout fragment pks' was transformed into the strain BSFX023 In the competent state, the recombinant strain BSFX024 was obtained; then, the P veg -The bte fragment is integrated at the ackA gene locus, and the bte gene insertion fragment bte' is fused by overlapping PCR with bte series primers, and the overlapping fragment bte' is transferred into strain BSFX024 to obtain recombinant strain BSFX025.

[0065] pps-LF-F:TTTTATTTGAAAGGGAAAGGCGATCC

[0066] pps-LF-R:AATGGCCTCTGTCCGCTAATCCGCTCGGATTCCTCTCAG...

Embodiment 2

[0093] The effect of embodiment 2 Bacillus subtilis genetically engineered bacteria BSFX022 and BSFX025 strains producing surfactin

[0094] Seed medium and fermentation medium components:

[0095] The components of the seed medium are: peptone 10g / L, yeast powder extract 5g / L, sodium chloride 10g / L.

[0096] The components of the fermentation medium are: sucrose 60g / L, peptone 10g / L, sodium nitrate 6g / L, potassium dihydrogen phosphate 3g / L, disodium hydrogen phosphate 10g / L, magnesium sulfate 0.5g / L, ferrous sulfate 0.02 g / L.

[0097] The steps of producing surfactin with Bacillus subtilis genetic engineering bacteria BSFX022 and BSFX025:

[0098] (1) Seed culture medium: Add 50 mL of seed culture medium to a 250 mL Erlenmeyer flask, and sterilize at 121°C for 20 minutes. After cooling, single colonies of BSFX022 and BSFX025 were picked and placed in the seed medium at 37°C and 200 rpm for 12 hours.

[0099] (2) Fermentation culture: Add 50 mL of fermentation medium into ...

Embodiment 3

[0103] Example 3 Identification of the HPLC and HPLC-MS spectra of the surfactin crude extracts produced by strains BSFX022 and BSFX025

[0104] Firstly, the surfactin in the BSFX022 and BSFX025 strains was crudely extracted, and the extraction steps were as follows:

[0105] The first step is crude extraction of surfactin: centrifuge the fermentation broth at 8000r / min for 10min to obtain the supernatant; then use 6mol / L HCl to adjust the pH of the supernatant to 2.0, and let it stand overnight at 4°C. Centrifuge the standing liquid at 8000r / min for 10min to collect the precipitate. The pH of the precipitate was adjusted to 7.0 with 11 mol / L NaOH, and then the precipitate was freeze-dried to obtain a yellow loose solid. The yellow solid was placed in methanol and fully extracted; then the extract was dried under vacuum at 40° C. to obtain a crude surfactin product.

[0106] According to the function of bte gene, we speculate that overexpression of bte gene may produce surfa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a genetically engineered bacterium for strengthening an nC14-surfactin component as well as a construction method and application of the genetically engineered bacterium. Thegenetically engineered bacterium is classified and named as Bacillus subtilis BSFX026, and has a preservation number of CCTCC (China Center For Type Culture Collection) NO: M 2020727. The nC14 component in the fermentation product surfactin of the bacterial strain is high, the accumulation of acetoin in the fermentation liquid is less, and the bacterial strain has better ex-situ MEOR application potential.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a strengthened nC 14 - Genetically engineered bacteria of surfactin components and its construction method and application. Background technique [0002] Microbial oil recovery technology (MEOR) has been more and more widely used in the field of crude oil extraction due to its advantages of greenness, environmental protection and degradability. MEOR can be divided into two types, in situ and ex situ, according to the different operation methods. In ex-situ microbial oil recovery (ex-situ MEOR) system, high-concentration oil displacement functional products such as biosurfactants and biopolymers obtained from surface fermentation are injected into oil layers as oil recovery aids to enhance oil recovery. Compared with in-situ microbial oil recovery technology (in-situ MEOR), ex-situ MEOR technology applies high-yield strains and makes them grow and metabol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/75C07K11/02C12P21/04E21B43/22C12R1/125
CPCC12N9/16C12N15/75C12N15/52C07K11/02C12P21/02C12Y301/02014E21B43/16
Inventor李霜胡仿香余定华黄和
OwnerNANJING UNIV OF TECH