Genetically engineered bacterium for strengthening nC14-surfactin component as well as construction method and application of genetically engineered bacterium

[0063] Example 1 Construction of Bisfx024 and BSFX025 strains

[0064] Step 1: Press the reverse screening mark, build the tapping slide fragment ΔPs 'and △ PKS'. Based on homologous recombination principle, the target fragment PPS 'and PKS' are constructed, and the PPS 'fragment is converted into the sensing state of the BSFX022, and the recombinant strain BSFX023 is obtained; the PKS gene knockout fragment PKS' is transformed into the strain BSFX023 In the feeling, recombinant strain BSFX024; then, P veg The -bte fragment is integrated at the ACKA gene site, and the PCR fuses the PCR insertion fragment Bte 'by BTE series primer, and the overlapping fragment BTE' is transferred to strain BSFx024 to obtain recombinant strain BSFX025.

[0065] PPS-LF-F: TTTTTTGAAAGGGAAAAGGCGATCC

[0066] PPS-LF-R: aatgcctctgtccgctaatccgctcgggattccctccAGTTCTCATAATA

[0067] PPS-DR-F: Tattatgagaactggaggaatccgagcgattagcgggagagagccatt

[0068] PPS-DR-R: TcattgtatacatcttTaaaataAtggcctctgtccccccccccccgct

[0069] PPS-PC-F: agcggattagcgggacagaggccattattttaaagtatgtatacaaatga

[0070] PPS-PC-R: TTAAAGAATAAAAAAAAGCCAGTCATTAAAAAAAGCCAGTCATTAGGCCCTA

[0071] PPS-RF-F: taggcctaatgactggcttttttataattgagcgaactttatttctttaa

[0072]PPS-RF-R: caggtgcgcagccagcggggctgcccccccgg

[0073] PKS-LF-F: agcgtatgtgatgccaagtatggag

[0074] PKS-LF-R: AGAATCGCTTTCACACACAACAAGAAAAAAT

[0075] PKS-DR-F: attttttttgttacaataaAagct aggcactagtgtgaaaagcgattctct

[0076] PKS-DR-R: TcattgtatactcttaaaaataAaataAtCTCAGAAAAAACAATAAC

[0077] PKS-PC-F: gttattgttttctgagatttttttttaaagtatgtatacaaatga

[0078] PKS-PC-R: TctCatgtcaattgttgcatttataAaagcccAgtcattaggccta

[0079] PKS-RF-F: taggcctaatgactggcttttttataaatgccaaaaaattgaccatgaga

[0080] PKS-RF-R: TAATGAGTGTGTCAATGCGACTG

[0081] BTE-LF-F: TTTATGGCIGAAAAAAAAAAAAAAAAAAAAAAAGGAACTGA

[0082] BTE-LF-R: AgTGTGATGCTGTGTAGATAGATCGATTGACGCTCCTTTTTACTCTGTA

[0083] P veg -F: gatctatcttacacagcatcacact

[0084] P veg -R: gtttgtcctccttattattagttaatct

[0085] BTE-F: AGATTAACTAATAAGGAGGACAAAC AtggctacaactctctTgcttctg

[0086] BTE-R: Acaacaatatgccccgttgttgaattaaacacgagegttcagcaggata

[0087] BTE-DR-F TatccctgctgaAcctcgtgttta atcgcatgaaagcacattctctTga

[0088] BTE-DR-R: TcattgtatacatcttTaaaAAttgagaaaaacagcgggtatgctGaatg

[0089] BTE-PC-F: cattcagcataccgctgtttctca attcgctgtttctca attcaaatga

[0090] BTE-PC-R: cgttaattgcaataatttggacatttataattttttaatctgttatttttttt

[0091] BTE-RF-F: AaataacagattaaaaaaAattata atgtccaaaattattgcaattaacg

[0092] BTE-RF-R: TGTTTCACCGATACCGCAGTAAA

[0093] Example 2 Surfactin for BSFX022 and BSFX025 strains of BSFX022 and BSFX025 strains

[0094] Seed medium and fermentation medium group:

[0095] Seed medium components are: protein 10g / L, yeast extract 5 g / L, sodium chloride 10g / L.

[0096] The fermentation medium is: sucrose 60 g / l, protein 胨 10g / L, sodium nitrate 6g / L, sodium phosphate, sodium hydrogen phosphate 10g / L, magnesium sulfate 0.5 g / L, ferrous sulfate 0.02 g / L.

[0097] Production Surfactin steps in BSFX022 and BSFX025 with Bacillus Bges:

[0098] (1) Seed medium: 50 ml of seed medium was added to a 250 mL conical bottle, and 20 min was sterilized at 121 and ° C. After cooling, BSFX022 and BSFX025 single colonies were collected in seed medium, 37, ° C 200 rpm, and cultured for 12 h.

[0099] (2) Fermentation culture: 50 ml of fermentation medium was added to a 250 mL conical bottle, and 20 min was sterilized at 121 and ° C. After cooling, the BSFx022, BSFX025 seed fluid at 2% (V / V) was transferred to the fermentation medium, 37 ° C, 200 rpm, and cultured 36 h.

[0100] (3) Analysis of the surfactin product: After 1 ml of the fermentation liquid sample taken at 4 hours, centrifuge at the rotational speed of 12000 rpm. 300 μl of the supernatant was added to 1,500 μL of anhydrous ethanol, mixed, 12000 rpm, centrifuge for 5 min, and beyond the sample to be detected. Using high performance liquid chromatography LC-20, at 214 nm wavelength, the flow phase is 90% (v / v) methanol, 10% water, VENUSIL XBP C18-P (4.6 × 150 mm, "at a flow rate of 0.8 ml / min. 5μm) Column chromatography column for detection.

[0101] (4) Determination of cell dry weight (DCW): Take 1 ml of fermentation broth 12 times, and measured the biomass of wavelength 600 with spectrophotometry, remembering OD600.

[0102] according to figure 1 It can be seen that the SurFactin of the BSFX025 strain has reached a maximum of 4.21 g / l at 24 hours, and the production rate is 0.175 g / l / h, and the highest SurFactin accumulation of the strain BSFX022 strain is up to 36 hours. 3.15 g / L, production The rate is 0.088 g / l / h. The growth amount of strains BSFX025 expressed in the BTE gene is lower than the BSFX022 strain.

[0103] Example 3 Identify the HPLC and HPLC-MS map of Surfactin produced by strain BSFX022 and BSFX025

[0104] First, the Surfactin in the BSFX022 and BSFX025 strains is extracted, and the extraction step is:

[0105] The first step is to carry out Surfactin: The fermentation broth was centrifuged under 8000 R / min for 10 min, and the supernatant was obtained; then the supernatant was adjusted using 6 mol / L of HCl to adjust the supernatant PH of 2.0, and allowed to stand overnight at 4 ° C. The sedation liquid was centrifuged under 8000 r / min for 10 min, and the precipitate was collected. The precipitate pH was 7.0 using 11 mol / L NaOH, and then the precipitate was lyophilized to obtain a yellow loose solid. The yellow solid was placed in methanol and fully extracted; then the extracted liquid was evacuated at 40 ° C, and the vacuum was rotated to dry, and the Surfactin crude product was obtained.

[0106] According to the function of the BTE gene, we speculate that the expression of the BTE gene may produce a Surfactin having a lipoyl chain length of 12 or 14. figure 2 The structural components of the SurFactin product of strain BSFX022 and strain BSFX025 can be seen from the strain BSFX022 and BSFX025 fermentation fluid. The mass spectrum of different components in the sample is then identified by HPLC-MS ( image 3 ), A structural component that may be represented by each molecular weight is shown in Table 1; wherein the structure of the 3, 5, 6, and 7 components is more clear. Combined with HPLC and HPLC-MS, it can be apparent that the composition ratio of strain BSFX025 expressed in the expression of BTE is significantly improved, which is c 14 -surfactin component.

[0107] Table 1 image 3 Structural analysis table of several Surfactin components

[0108]