Chemically modified high-stability RNA, kit and method

A highly stable, chemically modified technology, applied in biochemical equipment and methods, DNA/RNA fragments, DNA preparation, etc., can solve problems such as false negatives

Pending Publication Date: 2021-03-16
SICHUAN UNIV +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a chemically modified high-stability RNA and kit and method, which solves the problem that the existing RT-PCR detection uses DNA as a contrast and easily causes false negative results, and high-stability RNA is used as positive or negative Controls to avoid false negative results in RT-PCR assays

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chemically modified high-stability RNA, kit and method
  • Chemically modified high-stability RNA, kit and method
  • Chemically modified high-stability RNA, kit and method

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0027] Experimental example 1 Preparation of COVID-19 RNA test template and primers

[0028] 1. COVID-19 RNA template to be tested

[0029] A DNA fragment with the T7 promoter and containing the COVID-19 target sequence was prepared by PCR with plasmid DNA containing the COVID-19 target sequence (pCOVID-19 plasmid; purchased from Sangon, Shanghai, China). The COVID-19 RNA (sequence shown in SEQ ID NO.1) is finally obtained through T7 transcription.

[0030] The above-mentioned COVID-19 RNA is used as a template or RNA nucleic acid to be tested for RT-PCR. Clinical COVID-19 RNA samples can also be used as templates to be tested for RT-PCR.

[0031] 2. RT-PCR primers and probes

[0032] Design forward primer F, reverse internal primer B and Taqman probe, which are finally obtained by chemical synthesis, and the specific sequences are as follows:

[0033] Forward primer F: GGGGAACTTCCTGCTAGAAT (SEQ ID NO.2);

[0034] Reverse internal primer B: GAGACATTTTGCTCTCAAGCTG (SEQ ID ...

experiment example 2

[0036]Experimental example 2 using a commercial kit to detect COVID-19

[0037] 1. Positive control of commercial RT-PCR kit

[0038] For the detection of COVID-19 RNA, 6 commercial RT-PCR kits were used for real-time RT-PCR detection, and an appropriate amount of reaction mixture was prepared according to the number of samples (COVID-19 RNA nucleic acid to be tested), positive control and negative control (including buffers, enzymes, primers and probes, included in the kit). Then, pipette template (5 μL) and reaction mixture (20 μL) into each reaction tube, then mix the reaction solution and centrifuge at low speed, and finally carry out RT-PCR amplification.

[0039] Specifically, the RT-PCR amplification reaction system is: 10X buffer buffer, 0.2mM dNTP (including dATP, dTTP, dCTP and dGTP), forward and reverse primers 0.2μM each, Taq DNA polymerase 2.5U, reverse Recording enzyme 1U, appropriate amount of RNA nucleic acid to be tested, and then add ddH 2 0 to 25 μL. Whe...

experiment example 3

[0049] Experimental example 3 commercial kit KitA detection of COVID-19 RNA

[0050] The COVID-19 virus RNA sample (COVID-19RNA) was tested using batch 1 of the commercial kit KitA (KitA, Batch-1), and its positive control DNA was used as a reference. Such as figure 2 Shown are the detection results of different batches of commercial kit Kit A and commercial kit Kit B. In each figure, curve 1: COVID-19 positive RNA sample 1; curve 2: COVID-19 positive RNA sample 2; curve 3 : the positive control of the corresponding kit; Curve 4: the negative control of the corresponding kit. As can be seen from the figure, although the DNA control reported positive results as usual, batch 1 of the commercial kit KitA failed to report positive results for these positive viral RNA samples, indicating that the reverse transcription step in RT-PCR was ineffective, but DNA aggregated and PCR reactions are running normally. The integrity of these RNA samples was confirmed by commercial kit B (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses chemically modified high-stability RNA, a kit and a method. Oxygen atoms in phosphate ester of the high-stability RNA are replaced by S or Se. According to the chemically modified high-stability RNA, the kit and the method, the high-stability RNA is used as a positive or negative control of molecular detection and molecular research, the high-stability RNA is selenophosphate RNA, phosphorothioate RNA or selenophosphorothioate RNA, Se-RNA, S-RNA or Se-S-RNA can be used as a good template for reverse transcription, the high-stability RNA has good thermal stability, biological stability, nuclease hydrolysis resistance stability and chemical stability, and also has molecular selection, exclusiveness and specificity, which indicates that the high-stability RNA has greatpotential and application prospects as positive and negative controls of a nucleic acid detection system and molecular research, and in positive and negative controls for the molecular detection and the molecular research, at least one is the high-stability RNA.

Description

technical field [0001] The invention relates to a highly stable RNA, in particular to a chemically modified highly stable RNA, a kit and a method. Background technique [0002] Nucleic acid detection is an important means of diagnosing diseases such as infectious diseases, genetic diseases and tumors, such as the detection and diagnosis of the new coronavirus. Early diagnosis of COVID-19 is crucial to the prevention and control of this global epidemic. [0003] Real-time reverse transcription polymerase chain reaction (RT-PCR) is generally considered to be the most effective strategy for diagnosing COVID-19. However, recent studies have found that current RT-PCR kits provide unsatisfactory results due to a large number of false negative results (approximately 40%). False negative results are extremely dangerous and may cause many problems in COVID-19 prevention and epidemic control. Because the pathogen is highly contagious and deadly, a person with a false negative resul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/10C12Q1/70C12Q1/686C12Q1/6848C12Q1/6844
CPCC12N15/11C12Q1/701C12Q1/686C12Q1/6848C12Q1/6844C12N2310/315C12Q2600/166C12Q2525/113C12Q2545/113C12Q2521/107C12Q2531/119C12Q2537/1376
Inventor黄震罗光成张军
OwnerSICHUAN UNIV