Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of medicagotruncatula gene MtREVOLUTA in improving salt tolerance of leguminous affinis forage Medicago sativa L.

A technology of alfalfa and salt tolerance, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as changing the expression level of MtREVOLUTA

Active Publication Date: 2021-04-09
SHANDONG UNIV
View PDF11 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the expression level of transgenic MtREVOLUTA in Medicago truncatula is strictly regulated by MtmiR166, and the expression level of MtREVOLUTA without mutation cannot be changed by conventional transgene overexpression
After searching, MtREVOLUTA is different from the previously discovered MtREVOLUTA which is only responsible for regulating the development of leaves, and it is confirmed that MtREVOLUTA is a salt stress-responsive regulatory gene of Medicago truncatula, and MtREVOLUTA gene MtREVOLUTA of Medicago truncatula can present different functions in its close relative species, the forage grass Medicago truncatula. The literature or patents with high expression level and large amount of expression have not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of medicagotruncatula gene MtREVOLUTA in improving salt tolerance of leguminous affinis forage Medicago sativa L.
  • Application of medicagotruncatula gene MtREVOLUTA in improving salt tolerance of leguminous affinis forage Medicago sativa L.
  • Application of medicagotruncatula gene MtREVOLUTA in improving salt tolerance of leguminous affinis forage Medicago sativa L.

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Expression analysis of MtREVOLUTA

[0030] (1) Cultivation of materials

[0031] Moderately sand the hard skin of Medicago truncatula R108 seeds with sandpaper to break the dormancy of the seeds, culture them on wet filter paper at 4°C for about a week, then move the germinated seeds to seedling trays and place them in an incubator for growth. The environmental conditions of the incubator are: long sunshine (16h / 8h), temperature 23°C, humidity 65%, light intensity 150mmol m -2 the s -1 . Grow in the seedling tray for about two weeks (the first compound leaf grows and unfolds the leaves), move it into a large pot, and put it in the greenhouse for growth. The normal growth conditions in the greenhouse are: long sunshine (16h / 8h), temperature 22℃~25℃, humidity 60%-70%, light intensity 150mmol m -2 the s -1 . Salt treatment with 100 mM NaCl was started when the culture was one month old. After treatment for different time, RNA was extracted from seedling l...

Embodiment 2

[0070] Embodiment 2: Construction of dicotyledonous plant expression vector

[0071] Amplify MtREVOLUTA-specific primer sequences as follows:

[0072] MtREV-F:CACCATGGCTATGGCTGTTGCAC;

[0073] MtREV-qR: GGGGGTTTAAATCCAGCAATAGGTC.

[0074] 1) PCR system:

[0075]

[0076]

[0077] 2) PCR program:

[0078] 95°C for 5min; 25~30cycles 95°C for 30s, 60°C for 30s, 72°C for 30s; 72°C for 5min.

[0079] 3) Recycling Connection Transformation

[0080] After the PCR product was subjected to agarose gel electrophoresis, the gel block at the size of the target fragment was cut into a 1.5mL EP tube. PCR products were recovered according to the instructions of the common agarose gel DNA recovery kit (TIANGEN, DP209).

[0081] The recovered product was connected to the pEntry-T vector (Thermo Fisher Scientific, Cat. No. 12536017), and a large number of clones of the plasmid were obtained in Escherichia coli DH5α by transformation. Carry out LR reaction, connect the gene MtREVOLU...

Embodiment 3

[0082] Example 3: Transformation of alfalfa and screening of transgenic plants

[0083] The medium required for the genetic transformation of alfalfa was prepared according to the following formula.

[0084]

[0085] 1) Sterilize the culture medium in advance, and sterilize secondary water, petri dishes, filter paper, Erlenmeyer flasks, and 50mL centrifuge tubes.

[0086] 2) Agrobacterium preparation. Two days before the genetic transformation experiment, pick the Agrobacterium single clone or Agrobacterium stock that was successfully transformed as described in Example 2, load the corresponding antibiotics with 2mL LB liquid medium, and place it on a shaker at 200rpm at 28°C overnight.

[0087]3) Propagate 100 μL of shaken Agrobacterium liquid, place it in 30-50 mL of liquid culture medium (containing corresponding antibiotics), cultivate overnight at 200 rpm at 28°C, and the OD of the Agrobacterium liquid is 600 nm is about 0.8-1.0.

[0088] 4) Surface sterilization of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a medicagotruncatula gene MtREVOLUTA and a dicotyledon expression vector pEARLEYGATE100 containing the medicagotruncatula gene MtREVOLUTA in improving salt tolerance of leguminous affinis forage Medicago sativa L. The invention further discloses an application of the medicagotruncatula gene MtREVOLUTA in cultivating salt-tolerant Medicago sativa L. Experiments prove that the gene MtREVOLUTA is a response abiotic stress regulatory gene, and can be massively expressed in affinis leguminous forage Medicago sativa L., and the salt tolerance of transgenic Medicago sativa L. is obviously enhanced. The survival rate of the transgenic plant after high-salt treatment is higher than that of wild Medicago sativa L. SY4D. The application of the medicagotruncatula gene MtREVOLUTA in improving salt tolerance of leguminous affinis forage Medicago sativa L. is indicated to have important significance and economic value.

Description

technical field [0001] The invention relates to the application of the MtREVOLUTA gene of the Medicago truncatula, in particular to the application of the MtREVOLUTA gene of the Medicago truncatula in improving the salt tolerance of the forage grass Medicago truncatula, belonging to the technical field of biogenetic engineering. Background technique [0002] Legumes belong to dicotyledonous plants, with about 650 genera and 18,000 species, and their distribution range is extremely wide. Alfalfa belongs to the leguminous plant and is an important perennial high-quality forage grass in the world. It has high protein content and good palatability. It is the most economical source of feed whether it is used as pasture, silage or hay. For the "King of Grass". [0003] The study on the salt tolerance mechanism of alfalfa can provide theoretical basis and technical support for the genetic improvement and breeding of high-quality new strains of alfalfa. However, alfalfa is a cross...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/84A01H5/00A01H6/54
CPCC07K14/415C12N15/8273
Inventor 周传恩赵阳朱琳史建军
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com