Application of medicagotruncatula gene MtREVOLUTA in improving salt tolerance of leguminous affinis forage Medicago sativa L.
A technology of alfalfa and salt tolerance, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as changing the expression level of MtREVOLUTA
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1: Expression analysis of MtREVOLUTA
[0030] (1) Cultivation of materials
[0031] Moderately sand the hard skin of Medicago truncatula R108 seeds with sandpaper to break the dormancy of the seeds, culture them on wet filter paper at 4°C for about a week, then move the germinated seeds to seedling trays and place them in an incubator for growth. The environmental conditions of the incubator are: long sunshine (16h / 8h), temperature 23°C, humidity 65%, light intensity 150mmol m -2 the s -1 . Grow in the seedling tray for about two weeks (the first compound leaf grows and unfolds the leaves), move it into a large pot, and put it in the greenhouse for growth. The normal growth conditions in the greenhouse are: long sunshine (16h / 8h), temperature 22℃~25℃, humidity 60%-70%, light intensity 150mmol m -2 the s -1 . Salt treatment with 100 mM NaCl was started when the culture was one month old. After treatment for different time, RNA was extracted from seedling l...
Embodiment 2
[0070] Embodiment 2: Construction of dicotyledonous plant expression vector
[0071] Amplify MtREVOLUTA-specific primer sequences as follows:
[0072] MtREV-F:CACCATGGCTATGGCTGTTGCAC;
[0073] MtREV-qR: GGGGGTTTAAATCCAGCAATAGGTC.
[0074] 1) PCR system:
[0075]
[0076]
[0077] 2) PCR program:
[0078] 95°C for 5min; 25~30cycles 95°C for 30s, 60°C for 30s, 72°C for 30s; 72°C for 5min.
[0079] 3) Recycling Connection Transformation
[0080] After the PCR product was subjected to agarose gel electrophoresis, the gel block at the size of the target fragment was cut into a 1.5mL EP tube. PCR products were recovered according to the instructions of the common agarose gel DNA recovery kit (TIANGEN, DP209).
[0081] The recovered product was connected to the pEntry-T vector (Thermo Fisher Scientific, Cat. No. 12536017), and a large number of clones of the plasmid were obtained in Escherichia coli DH5α by transformation. Carry out LR reaction, connect the gene MtREVOLU...
Embodiment 3
[0082] Example 3: Transformation of alfalfa and screening of transgenic plants
[0083] The medium required for the genetic transformation of alfalfa was prepared according to the following formula.
[0084]
[0085] 1) Sterilize the culture medium in advance, and sterilize secondary water, petri dishes, filter paper, Erlenmeyer flasks, and 50mL centrifuge tubes.
[0086] 2) Agrobacterium preparation. Two days before the genetic transformation experiment, pick the Agrobacterium single clone or Agrobacterium stock that was successfully transformed as described in Example 2, load the corresponding antibiotics with 2mL LB liquid medium, and place it on a shaker at 200rpm at 28°C overnight.
[0087]3) Propagate 100 μL of shaken Agrobacterium liquid, place it in 30-50 mL of liquid culture medium (containing corresponding antibiotics), cultivate overnight at 200 rpm at 28°C, and the OD of the Agrobacterium liquid is 600 nm is about 0.8-1.0.
[0088] 4) Surface sterilization of...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com