Cloning and functional expression method of typha orientalis heavy metal ATPase gene TyHMA3

A technology of expression method and cloning method, applied in the field of comprehensive utilization of biotechnology, can solve problems such as lack of functional expression method, and achieve the effect of improving plant stress resistance and increasing crop yield

Inactive Publication Date: 2021-04-09
HUAIYIN INSTITUTE OF TECHNOLOGY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is a lack of corresponding functional expression methods for the excellent heavy metal tolerance of Typha and the characteristics of heavy metal accumulation in the underground.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cloning and functional expression method of typha orientalis heavy metal ATPase gene TyHMA3
  • Cloning and functional expression method of typha orientalis heavy metal ATPase gene TyHMA3
  • Cloning and functional expression method of typha orientalis heavy metal ATPase gene TyHMA3

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] A Typha heavy metal ATPase gene THMA3 A cloning method comprising the following steps,

[0053] S1. Typha of the variety "Huaipu No. 1" was selected as the test material, and it was planted in the Laboratory of Horticultural Crop Systems Biology of Huaiyin Institute of Technology in March 2017;

[0054] S2. Put the cattail seedlings in S1 into the Hoagland nutrient solution and cultivate them. When the leaves grow to 30cm, select normal strong and consistent plants, and cut the roots, stems, pseudostems, and leaf tissue samples;

[0055] S3. Refer to the instructions of the plant RNA extraction kit from TIANGEN (Beijing) to extract the total mRNA of each sample in S2, and mix 2 μL in equal proportions;

[0056] S4. Using the PrimeScript RT-PCR Kit (TaKaRa, Japan) kit, construct a cattail cDNA library;

[0057] S5. The third-generation transcriptome sequencing data and annotation results of cattail tissue, search and splicing of cattail HMA gene;

[0058] S6. The cDNA...

Embodiment 2

[0062] A Typha heavy metal ATPase gene THMA3 The function expression method includes the following steps:

[0063] D1. Material Handling and Sampling:

[0064] (1) CK, normal Hoagland nutrient solution;

[0065] (2) T1, 0.1 mM Pb(NO 3 ) 2 deal with;

[0066] (3) T2, 0.25 mM Pb(NO 3 ) 2 deal with;

[0067] (4) T3, 0.05 mM CdCl 2 deal with;

[0068] (5) T4, 0.15 mM CdCl 2 deal with;

[0069] The root and leaf tissues were cut at 0, 2, 6, 12, 24, 48 h and 96 h, respectively, and repeated three times. Each time, 0.2 g of fresh samples were taken, quick-frozen in liquid nitrogen for 1 h, and then stored in a -80 °C refrigerator for later use;

[0070] D2. Extract the total RNA from different tissues and treatments of Typha D1, reverse transcribe it into cDNA, and detect it by real-time fluorescent quantitative PCR THMA3 relative gene expression. THMA3 Gene-specific quantitative primers qHMA3-F (TGGTTATATCAGTGTAAGAA) and qHMA3-R (CAGGAATCTATCAATCTCT), the internal re...

Embodiment 3

[0072] Example 3 THMA3 Sequence analysis

[0073] First, use the BioEdit software to find THMA3 The open reading frame (ORF) of the sequence, and translated into amino acid sequence, through NCBI (https: / / www.ncbi.nlm.nih.gov / ), Pfam (http: / / pfam.janelia.org / ) and SMART (http: / / smart.embl-heidelberg.de / ) databases to validate the obtained genes. After that, through EMBOSS (https: / / www.ebi.ac.uk / Tools / emboss / ), ProtParam

[0074] (https: / / web.expasy.org / protparam / ), TMHMM (http: / / www.cbs.dtu.dk / services / TMHMM / ), WoLF PSORT (https: / / wolfpsort.hgc.jp / ) and The SOPMA (http: / / pbil.ibcp.fr / ) program analyzes the basic characteristics of protein sequences, including molecular weight, isoelectric point, instability index, hydrophobicity, transmembrane domain and protein secondary structure. Finally, the three-dimensional protein structure analysis is predicted by ConSurf (https: / / consurf.tau.ac.il / ) and SWISS-MODEL (https: / / swissmodel.expasy.org / ), respectively.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the field of biotechnology comprehensive utilization, and discloses a cloning and functional expression method of a typha orientalis heavy metal ATPase gene TyHMA3. The typha orientalis heavy metal ATPase gene TyHMA3 is a nucleotide sequence shown as SEQ ID NO.1 in a sequence table. The amino acid sequence is shown as SEQ ID NO.2 in a sequence table. The invention relates to a PCR primer group capable of amplifying SEQID NO.1. The primer group is as follows: HMA-F (TCTCAGTCTACTATTTAG) and HMA-R (TCAATCATAAAGAAGAAA). The invention discloses a vector for cloning the typha orientalis heavy metal ATPase gene TyHMA3. The vector is a pMD19-T vector. The gene TyHMA3 provided has the highest expression quantity in typha orientalis roots, has tissue specificity, is induced by Cd2+ and Pb2+, and is rapidly and strongly expressed. The gene participates in regulating and controlling the tolerance of typha orientalis to heavy metals. A theoretical basis is provided for a typha orientalis heavy metal strong tolerance mechanism, and a promotion effect is provided for utilization of plant heavy metal tolerance.

Description

technical field [0001] The invention relates to the field of comprehensive utilization of biotechnology, in particular to a cattail heavy metal ATPase gene THMA3 cloning and functional expression methods. Background technique [0002] With the development of industry and agriculture, soil heavy metal pollution is becoming more and more serious, among which the more prominent heavy metals are cadmium (Cd) and lead (Pb). High concentration of Cd 2+ and Pb 2+ After being absorbed by plants, it will cause cell membrane degradation, ion extravasation and loss of enzyme activity, and can interfere with normal physiological and biochemical processes such as plant water absorption, ion transport, cell metabolism, etc., causing great damage to plants, and even leading to withering and death. [0003] P-type ATPase (P-ATPase) is a superfamily of transporters that transport metal cations across membranes by hydrolyzing ATP. Members of this family can selectively absorb and transport...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N15/10C12N15/11C12Q1/6895
CPCC12N9/14C12Y306/03C12Q1/6895C12Q2600/13C12Q2600/158
Inventor黄志楠段伟科王云鹏王晓莉孙小川靳丛刘雨婷
OwnerHUAIYIN INSTITUTE OF TECHNOLOGY