Yarrowia lipolytica engineering bacterium for producing limonene, and application
A technology of Yarrowia lipolytica and limonene, applied in the field of genetic engineering, to achieve the effects of increasing yield, increasing yield, and shortening lag period
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Construction of Example 1 bacterial strain Po1g△KU70-pYLEX1-YALI0F19492p
[0046] The build process is as follows:
[0047] (1) using Yarrowia lipolytica engineering strain Po1g△KU70 genomic DNA as a template, using primers YALI0F19492p-F / R to amplify the YALI0F19492p gene;
[0048] YALI0F19492p-F:
[0049] ATACAACCACACATCCACAATGCCCGACGACCACCGAGAG
[0050] YALI0F19492p-R:
[0051] TGGATCCTTAGTTTCGGGTTCCTTTATTGTTGCTCAGGATCAACATC
[0052] PCR reaction conditions: 95°C for 5min; 95°C for 15s; 55°C for 15s; 72°C for 30s, 30 cycles; 72°C for 10min, 1% agarose gel electrophoresis to identify the amplified product;
[0053] PCR reaction system (20μL, Vazyme, Nanjing, 2×Phanta Max Master Mix P515 kit)
[0054] template DNA Upstream and downstream primers 2×Phanta Max Master Mix wxya 2 o
total capacity 1.0 μL 1.0μL each 10μL 7μL 20 μL
[0055] (2) The pYLEX1 plasmid was digested with Pml1, and the YALI0F19492p gene fragment was ligate...
Embodiment 2
[0060] Embodiment 2 measures the engineering strain growth curve after recombination
[0061] (1) Adding 3% dimethyl sulfoxide (DMSO) to the influence of Yarrowia lipolytica engineering bacterial strain Po1g△KU70 growth in measuring 50mlYPD medium, the result is as follows figure 2 Shown, prove that adding 3% dimethyl sulfoxide (DMSO) has no effect on the growth of bacterial strain;
[0062] (2) With dimethyl sulfoxide (DMSO) as a solvent, limonene (type D) was dissolved and added to a 250ml Erlenmeyer flask containing 50ml of YPD medium. The final concentration of D-limonene in the medium was 1000mg / L, and cultured The final concentration of DMSO in the base is 3%;
[0063] (3) Take the recombined genetically engineered bacteria Po1g△KU70-pYLEX1-YALI0F19492p ring, and use the wild-type strain Po1g△KU70 as a control, inoculate in a test tube containing 5mL of YPD medium, 30°C, 225r / min, shaking culture After 24h, take the initial OD 600 =0.1 was inoculated in the medium in...
Embodiment 3
[0065] Example 3 Determination of the output of the recombined engineering strain limonene
[0066] (1) According to the dLS gene sequence in Genbank, the gene synthesis company synthesized the D-limonene synthase gene (dLS, GenBank ID: AF514289) from lemon (C.limon).
[0067] (2) The pYLEX1 plasmid was single-digested with Pml1, and the dLS gene fragment was ligated with the digested pYLEX1 plasmid to obtain the recombinant plasmid pYLEX1-dLS.
[0068] (3) The dLS expression cassette was amplified by PCR using primer BDH-F / R from the recombinant plasmid pYLEX1-dLS, and then the dLS expression cassette was cloned into the linearized plasmid pYLEX1-YALI0F19492p after NruI digestion to obtain a recombinant plasmid pYLEX1-YALI0F19492p-dLS.
[0069] BDH-F: ccatccagcctcgcgtcgGTTAACTATCCTAGGGTGCATGCTGAG
[0070] BDH-R: acgtcttgctggcgttcgcgaTCATCGATGATAAGCTGTCAAACA
[0071] (4) After linearizing the recombinant plasmids pYLEX1-dLS and pYLEX1-YALI0F19492p-dLS in (2) and (3) with Sp...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


