Unlock instant, AI-driven research and patent intelligence for your innovation.

Yarrowia lipolytica engineering bacterium for producing limonene, and application

A technology of Yarrowia lipolytica and limonene, applied in the field of genetic engineering, to achieve the effects of increasing yield, increasing yield, and shortening lag period

Active Publication Date: 2021-04-09
TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, candidate genes exhibiting high differential expression in genome sequence alignments do not necessarily increase tolerance, and increased tolerance does not necessarily accompany increased yield, and therefore, most candidate genes are highly effective in both tolerance and yield The role of the

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yarrowia lipolytica engineering bacterium for producing limonene, and application
  • Yarrowia lipolytica engineering bacterium for producing limonene, and application
  • Yarrowia lipolytica engineering bacterium for producing limonene, and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Construction of Example 1 bacterial strain Po1g△KU70-pYLEX1-YALI0F19492p

[0046] The build process is as follows:

[0047] (1) using Yarrowia lipolytica engineering strain Po1g△KU70 genomic DNA as a template, using primers YALI0F19492p-F / R to amplify the YALI0F19492p gene;

[0048] YALI0F19492p-F:

[0049] ATACAACCACACATCCACAATGCCCGACGACCACCGAGAG

[0050] YALI0F19492p-R:

[0051] TGGATCCTTAGTTTCGGGTTCCTTTATTGTTGCTCAGGATCAACATC

[0052] PCR reaction conditions: 95°C for 5min; 95°C for 15s; 55°C for 15s; 72°C for 30s, 30 cycles; 72°C for 10min, 1% agarose gel electrophoresis to identify the amplified product;

[0053] PCR reaction system (20μL, Vazyme, Nanjing, 2×Phanta Max Master Mix P515 kit)

[0054] template DNA Upstream and downstream primers 2×Phanta Max Master Mix wxya 2 o

total capacity 1.0 μL 1.0μL each 10μL 7μL 20 μL

[0055] (2) The pYLEX1 plasmid was digested with Pml1, and the YALI0F19492p gene fragment was ligate...

Embodiment 2

[0060] Embodiment 2 measures the engineering strain growth curve after recombination

[0061] (1) Adding 3% dimethyl sulfoxide (DMSO) to the influence of Yarrowia lipolytica engineering bacterial strain Po1g△KU70 growth in measuring 50mlYPD medium, the result is as follows figure 2 Shown, prove that adding 3% dimethyl sulfoxide (DMSO) has no effect on the growth of bacterial strain;

[0062] (2) With dimethyl sulfoxide (DMSO) as a solvent, limonene (type D) was dissolved and added to a 250ml Erlenmeyer flask containing 50ml of YPD medium. The final concentration of D-limonene in the medium was 1000mg / L, and cultured The final concentration of DMSO in the base is 3%;

[0063] (3) Take the recombined genetically engineered bacteria Po1g△KU70-pYLEX1-YALI0F19492p ring, and use the wild-type strain Po1g△KU70 as a control, inoculate in a test tube containing 5mL of YPD medium, 30°C, 225r / min, shaking culture After 24h, take the initial OD 600 =0.1 was inoculated in the medium in...

Embodiment 3

[0065] Example 3 Determination of the output of the recombined engineering strain limonene

[0066] (1) According to the dLS gene sequence in Genbank, the gene synthesis company synthesized the D-limonene synthase gene (dLS, GenBank ID: AF514289) from lemon (C.limon).

[0067] (2) The pYLEX1 plasmid was single-digested with Pml1, and the dLS gene fragment was ligated with the digested pYLEX1 plasmid to obtain the recombinant plasmid pYLEX1-dLS.

[0068] (3) The dLS expression cassette was amplified by PCR using primer BDH-F / R from the recombinant plasmid pYLEX1-dLS, and then the dLS expression cassette was cloned into the linearized plasmid pYLEX1-YALI0F19492p after NruI digestion to obtain a recombinant plasmid pYLEX1-YALI0F19492p-dLS.

[0069] BDH-F: ccatccagcctcgcgtcgGTTAACTATCCTAGGGTGCATGCTGAG

[0070] BDH-R: acgtcttgctggcgttcgcgaTCATCGATGATAAGCTGTCAAACA

[0071] (4) After linearizing the recombinant plasmids pYLEX1-dLS and pYLEX1-YALI0F19492p-dLS in (2) and (3) with Sp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a Yarrowia lipolytica engineering bacterium for producing limonene, and application and construction of the Yarrowia lipolytica engineering bacterium. The invention firstly provides application of a gene in limonene production, wherein the gene is specifically YALI0F19492p, a Genbank number is 2907674, and the YALI0F19492p gene has an outstanding regulation and control function for the limonene production. The invention provides the Yarrowia lipolytica engineering bacterium for producing the limonene, a bacterial strain is obtained by overexpression of the YALI0F19492p gene in a Yarrowia lipolytica host cell and expression of limonene synthase, the yield of the limonene produced by fermentation is improved by about eight times, and while the yield is improved, a train of thought is provided for researching the limonene production bacterial strain.

Description

Technical field: [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Yarrowia lipolytica engineering bacterium producing limonene and its construction and application. Background technique: [0002] Yarrowia lipolytica (Yarrowialipolytica) is a typical representative unconventional yeast. The yeast is non-pathogenic, the maximum growth temperature is generally below 34°C, and has been identified as a (generally regarded assafe, GRAS) safety-level microorganism. Different from Saccharomyces cerevisiae, this yeast is strictly aerobic and has the characteristics of dimorphic growth. Growth conditions such as carbon source, nitrogen source, and pH will affect the colony morphology of this bacteria, so it has become a research tool for yeast and fungal hyphae. Differentiated model strains. Another remarkable advantage of this yeast is that it widely exists in various foods and various living environments, because it can uti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N1/19C12P5/00C12R1/645
CPCC12N15/815C07K14/39C12N9/88C12P5/007
Inventor 于爱群李建苗琳荣兰新赵禹李圣龙张翠英肖冬光
Owner TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY