Method for enzymatic synthesis of nicotinamide cytosine dinucleotide and application thereof

A technology of nicotinamide cytosine dinucleotide and cytosine nucleoside triphosphate, which is applied in the directions of transferase, fermentation, etc., can solve the problems of difficult entry of NCD into cells, difficulty in separation and purification, and complicated steps, and achieve easy separation and reaction. The effect of high efficiency and simple reaction process

Active Publication Date: 2021-04-23
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Aiming at the disadvantages of cumbersome chemical synthesis steps, difficult separation and purification, NCD is difficult to enter cells, and no enzyme that can efficiently catalyze the synthesis of NCD has been found so far. The purpose of the present invention is to provide an efficient enzymatic synthesis of NCD. The mutant of amide mononucleotide adenylyltransferase is used as a catalyst to catalyze the synthesis of NCD with nicotinamide mononucleotide and cytidine nucleoside triphosphate as substrates, and through the intracellular expression of nicotinamide mononucleotide adenosyltransferase Mutants of glycosyltransferases can directly synthesize NCD in cells, and can be used to selectively regulate metabolic processes and increase the yield of target metabolites

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for enzymatic synthesis of nicotinamide cytosine dinucleotide and application thereof
  • Method for enzymatic synthesis of nicotinamide cytosine dinucleotide and application thereof
  • Method for enzymatic synthesis of nicotinamide cytosine dinucleotide and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 122D8

[0078] Example 1 22D8 Catalyzed Synthesis of NCD

[0079] 1. Construction of mutant library

[0080] The mutation library was constructed by RF cloning (F. van den Ent, et al. Journal of Biochemical and Biophysical Methods. 2006, 67, 67). In the first step, the template is the wild-type NadD expression vector pUC-NadD, and the primers replace the codon of the 22nd proline with the degenerate base NNK (N=A,C,G,T; K=G,T) , carry out PCR reaction and recover the PCR product; the second step, the template is the same as the first step, and the primer is the PCR product recovered in the first step, and the obtained product is digested with DpnI restriction enzyme, and transferred into DH10B competent cells to obtain The transformant is a single point saturation mutation library that can express the mutation of proline at position P22 to any amino acid. The expression bacteria of each mutant are named DH10B (pUC-NadD-xxx), and the expressed protein product is named xxx. Among them...

Embodiment 21E

[0091] Example 2 Catalytic synthesis of NCD by 1E4

[0092] 1. Construction of mutant library

[0093] The mutation library was constructed by RF cloning (F. van den Ent, et al. Journal of Biochemical and Biophysical Methods. 2006, 67, 67). In the first step, the template is the mutant protein expression vector pUC-NadD-22D8 in Example 1, and the primers are the corresponding codons of cysteine ​​at position 132 and tryptophan at position 175 are replaced with degenerate base groups CKC and TWT , SAA (equal molar ratio, K=G, T; W=A, T; S=C, G) primer pair, PCR reaction and recovery product; second step, template is the same as the first step, and primer is the first step The PCR product recovered in the medium was digested with DpnI restriction enzyme, and transferred to DH10B competent cells, and the obtained transformant was a mutation library capable of expressing NadD mutants, and each mutant expression strain was named as DH10B ( pUC-NadD-xxx), the expressed protein pro...

Embodiment 3

[0104] Embodiment 3 combinatorial mutant 1E4-11B4 catalyzes the synthesis of NCD

[0105] 1. Construction of 1E4-11B4 combined mutant expression vector

[0106] Combination mutant expression vectors were constructed using the method of RF cloning (F. van den Ent, et al. Journal of Biochemical and Biophysical Methods. 2006, 67, 67). In the first step, the template is the mutant protein expression vector pUC-NadD-11B4, the upstream primer is NadD-33-44-s (ggtctgacgcgggtcacaatcatccctaataatgttcctcc), the downstream primer is NadD-119-131-a (gacgatcaaatgtgcattgtcgagtatcgtttcgtattc), and the PCR reaction is carried out and the product is recovered In the second step, the template is the mutant protein expression vector pUC-NadD-1E4, and the primers are the PCR product recovered in the first step, and the product obtained is digested with DpnI restriction enzyme, and transferred into DH10B competent cells, and the obtained transformation The child is the expressable combination muta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for enzymatic synthesis of nicotinamide cytosine dinucleotide and application thereof. A nicotinamide mononucleotide adenosine transferase mutant is used as a catalyst to catalyze coupling reaction of nicotinamide mononucleotide and cytidine triphosphate, so as to prepare nicotinamide cytidine dinucleotide. The coding gene of the nicotinamide mononucleotide adenosine transferase mutant is expressed in microbial cells, engineering bacteria synthesize nicotinamide cytosine dinucleotide by using endogenous metabolites, and the intracellular nicotinamide cytosine dinucleotide can be used as a coenzyme to selectively mediate redox reaction and improve the yield of target metabolites. In one typical example, the yield of L-malic acid is increased by 79%. In another typical example, the conversion rate of producing D-lactic acid from L-malic acid is increased by 2.4 times.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to a method for enzymatically synthesizing nicotinamide cytosine dinucleotide (NCD) and its application, and expressing mutants of nicotinamide mononucleotide adenylyltransferase in microbial cells The coding gene of the engineered bacteria uses endogenous metabolites to synthesize NCD, and intracellular NCD can act as a coenzyme to selectively mediate redox reactions and increase the yield of target metabolites. Background technique [0002] Nicotinamide adenine dinucleotide (NAD) and its reduced state (NADH) play a very important role in cell reproduction, growth, differentiation, apoptosis and other life activities (W.Ying, et al.Antioxidants&RedoxSignaling.2008 , 10, 179). In addition, NAD(H) is also the coenzyme of many important redox enzymes, which plays the role of transferring hydrogen and electrons. [0003] Since NAD(H) participates in multiple reactions in organis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P19/36C12N9/12
Inventor赵宗保王雪颖
OwnerDALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI