Novel constitutive promoter, recombinant bacillus licheniformis and application of recombinant bacillus licheniformis
A Bacillus licheniformis, constitutive promoter technology, applied in the field of genetic engineering and enzyme engineering, can solve the problems of lack of efficient methods for maltotriose amylase, unsatisfactory expression of heterologous genes, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Cloning of the P2 promoter
[0031] Using the genome of Bacillus licheniformis CICIM B1391 as a template, PH2-F / PH2-R as primers for PCR amplification, enzyme digestion and purification to obtain the promoter fragment, cloned into the pHY300-PLK plasmid to obtain the P2 promoter expression vector.
[0032] PH2-F:CCCAAGCTTCATCTCAATTATACAAAGAAGGAA
[0033] PH2-R:GCGTCGACTTTCCTTTCACCTCTTAATTAATTTT
Embodiment 2
[0035] Construction of expression vector of maltotriose amylase by promoter P2
[0036] The maltotriose amylase gene fragment sacBss-tfa-ter of the fructan synthase signal peptide and terminator fused by PCR was digested with BamHI and SmaI to recover the target fragment, cloned into the P2 expression vector, and transformed into E.coli JM109 realizes the construction of expression vector. The plasmid was named pHY-P2-tfa.
Embodiment 3
[0038] Transformation of recombinant plasmid pHY-P2-tfa
[0039] Bacillus licheniformis ATCC14580, Bacillus licheniformis ATCC12759, Bacillus licheniformis ATCC9945, Bacillus licheniformis ATCC13438 and Bacillus licheniformis ATCC9259 were respectively activated on the plate and inoculated in 15mL of LB medium for overnight culture at 37°C and 250rpm. Transfer 1 mL of the culture solution to 30 mL of medium I, culture at 37°C, 250 rpm for 4.5 h, then ice-bath for 10 min, centrifuge at 6000 rpm for 10 min to collect the cells, and wash the cells with buffer BW 4 times. Suspend the bacteria with 750 μL of buffer, and dispense 80 μL into 1.5 mL centrifuge tubes. Add the plasmid to the competent Bacillus licheniformis, transfer the cells to the electroporation cup, place on ice for 5 min, use an electrotransformer at 2000V to shock once, and immediately add 800 μL of recovery medium BR. Incubate at 37°C, 100rpm for 3h, and spread on the screening plate. The transformation of Bac...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


