Novel constitutive promoter, recombinant bacillus licheniformis and application of recombinant bacillus licheniformis

A Bacillus licheniformis, constitutive promoter technology, applied in the field of genetic engineering and enzyme engineering, can solve the problems of lack of efficient methods for maltotriose amylase, unsatisfactory expression of heterologous genes, etc.

Active Publication Date: 2021-05-14
JIANGNAN UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In view of the fact that Bacillus licheniformis, an important industrial microorganism, lacks synthetic biology standardized elements, the existing promoters are mainly derived from model microorganisms such as Bacillus subtilis, the effect of expressing heterologous genes is not ideal, and there is a lack of efficient methods for producing maltotriose amylase. The invention provides a novel constitutive P2 promoter derived from Bacillus licheniformis and a recombinant plasmid of maltotriose amylase gene, which can realize the efficient preparation of maltotriose amylase in a food-safe microbial host of Bacillus licheniformis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel constitutive promoter, recombinant bacillus licheniformis and application of recombinant bacillus licheniformis
  • Novel constitutive promoter, recombinant bacillus licheniformis and application of recombinant bacillus licheniformis
  • Novel constitutive promoter, recombinant bacillus licheniformis and application of recombinant bacillus licheniformis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Cloning of the P2 promoter

[0031] Using the genome of Bacillus licheniformis CICIM B1391 as a template, PH2-F / PH2-R as primers for PCR amplification, enzyme digestion and purification to obtain the promoter fragment, cloned into the pHY300-PLK plasmid to obtain the P2 promoter expression vector.

[0032] PH2-F:CCCAAGCTTCATCTCAATTATACAAAGAAGGAA

[0033] PH2-R:GCGTCGACTTTCCTTTCACCTCTTAATTAATTTT

Embodiment 2

[0035] Construction of expression vector of maltotriose amylase by promoter P2

[0036] The maltotriose amylase gene fragment sacBss-tfa-ter of the fructan synthase signal peptide and terminator fused by PCR was digested with BamHI and SmaI to recover the target fragment, cloned into the P2 expression vector, and transformed into E.coli JM109 realizes the construction of expression vector. The plasmid was named pHY-P2-tfa.

Embodiment 3

[0038] Transformation of recombinant plasmid pHY-P2-tfa

[0039] Bacillus licheniformis ATCC14580, Bacillus licheniformis ATCC12759, Bacillus licheniformis ATCC9945, Bacillus licheniformis ATCC13438 and Bacillus licheniformis ATCC9259 were respectively activated on the plate and inoculated in 15mL of LB medium for overnight culture at 37°C and 250rpm. Transfer 1 mL of the culture solution to 30 mL of medium I, culture at 37°C, 250 rpm for 4.5 h, then ice-bath for 10 min, centrifuge at 6000 rpm for 10 min to collect the cells, and wash the cells with buffer BW 4 times. Suspend the bacteria with 750 μL of buffer, and dispense 80 μL into 1.5 mL centrifuge tubes. Add the plasmid to the competent Bacillus licheniformis, transfer the cells to the electroporation cup, place on ice for 5 min, use an electrotransformer at 2000V to shock once, and immediately add 800 μL of recovery medium BR. Incubate at 37°C, 100rpm for 3h, and spread on the screening plate. The transformation of Bac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a novel constitutive promoter, recombinant bacillus licheniformis and application thereof, and belongs to the technical field of gene engineering and enzyme engineering. The method comprises the following steps: obtaining a strong constitutive promoter P2 from bacillus licheniformis and a target gene of maltotriose amylase from Thermobifida fusca NTU22 through PCR (Polymerase Chain Reaction), constructing a recombinant plasmid pHY-P2-tfa, and transforming the recombinant plasmid pHY-P2-tfa into bacillus licheniformis, so as to obtain the recombinant bacillus licheniformis. According to the invention, food-safe bacillus licheniformis is taken as an expression host, and a novel high-activity promoter P2 is utilized to realize recombinant expression of maltotriose amylase. The mixed carbon source maltodextrin of 60 g/L, glucose of 10 g/L and the fermentation condition of 42 DEG C are more beneficial to enzyme production, and the highest enzyme activity of recombinant bacterium fermentation reaches 578.47 U/mL.

Description

technical field [0001] The invention belongs to the technical fields of genetic engineering and enzyme engineering, and in particular relates to a novel constitutive promoter, recombinant bacillus licheniformis and applications thereof. Background technique [0002] Promoter is one of the basic expression elements of synthetic biology and plays an important role in the regulation of anabolism. In the process of gene expression, RNA polymerase can specifically recognize and bind to the specific sequence of the promoter, thereby controlling the initiation time and expression intensity of gene transcription and expression. When industrial microorganisms express and synthesize high value-added compounds, the regulation of the promoter on the synthetic pathway often determines the production efficiency. [0003] The research and application of promoters in eukaryotic and prokaryotic expression systems has been relatively mature. In yeast, constitutive promoters such as PTEF, PH...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N1/21C12N15/56C12N15/75C12N9/24C12R1/10
CPCC12N9/2402C12N15/75C12N1/20C12Y302/01133
Inventor 石贵阳李由然赵鑫馨张梁丁重阳徐沙顾正华
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap