Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant bacterium containing novel PHA chimeric enzyme and preparation method and application of recombinant bacterium

A recombinant bacterium, a new type of technology, applied in the field of molecular biology, can solve the problem of low production capacity of PHA, and achieve the effect of increasing the production of PHA

Pending Publication Date: 2021-05-25
LIAONING UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

While Aeromonas hydrophila WQ (A.hydrophila WQ) PHA synthase (PhaC Ah ) has a broad substrate range and produces P(3HB-co-3HHx), but its ability to produce PHA is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacterium containing novel PHA chimeric enzyme and preparation method and application of recombinant bacterium
  • Recombinant bacterium containing novel PHA chimeric enzyme and preparation method and application of recombinant bacterium
  • Recombinant bacterium containing novel PHA chimeric enzyme and preparation method and application of recombinant bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 contains phaC Ah Synthase Recombinant Bacteria and Its Application

[0048] In this embodiment, the parent uses Aeromonas hydrophila WQ (A.hydrophila WQ) PHA synthase (PhaC Ah ).

[0049] 1. PHA synthase gene cloning:

[0050] The sequence of Aeromonas hydrophila WQ (A.hydrophila WQ) was obtained from NCBI, and primers AH1 and AH2 were designed based on this sequence.

[0051] Using the plasmid pUC19-PhaPCJ preserved in our laboratory as a template, with AH1 as the upstream primer and AH2 as the downstream primer, PhaC was amplified by PCR Ah .

[0052] AH1 sequence is: GCT AAGCTT CTAATGAGCCAACCATCTTAT

[0053] AH2 sequence is: TTT GAATTC TCATGCGGCGTCCT

[0054] The PCR amplification system is: ddH2O 32.5 μl, 5×Prime STARES DNA Polymerase buffer 10 μl, dNTP Mixture 4 μl, template DNA 1 μl, upstream primer AH1 (10 μM) 1 μl, downstream primer AH2 (10 μM) 1 μl, PrimeSTARES DNA Polymerase 0.5 μl.

[0055] PCR amplification conditions were: pre-denaturati...

Embodiment 2

[0078] Example 2 contains phaC Re Synthase Recombinant Bacteria and Its Application

[0079] In this embodiment, the parent uses R.eutropha PHA synthase (PhaC Re ).

[0080] 1. PHA synthase gene cloning:

[0081] The sequence of Alcaligenes eutropha H16 (R.eutropha H16) was obtained from NCBI, and primers RH1 and RH2 with HindIII and EcoRI restriction sites were designed based on this sequence.

[0082] Using the R.eutropha genome as a template, using RH1 as the upstream primer and RH2 as the downstream primer, phaC was amplified by PCR Re .

[0083] The RH1 sequence is: GAT AAGCTT CTAATGGCGACCGGCAAAGG

[0084] The RH2 sequence is: TAC GAATTC TCATGCCTTGGCTTTGACGT

[0085] The PCR amplification system is: ddH2O 32.5 μl, 5×Prime STARES DNA Polymerase buffer 10 μl, dNTP Mixture 4 μl, template DNA 1 μl, upstream primer RH1 (10 μM) 1 μl, downstream primer RH2 (10 μM) 1 μl, PrimeSTARES DNA Polymerase 0.5 μl.

[0086] PCR amplification conditions were: pre-denaturation at 9...

Embodiment 3

[0109] Embodiment 3 contains the recombinant bacterium of novel PHA chimeric enzyme and its application

[0110] 1) Secondary structure prediction to find chimeric enzyme binding sites

[0111] Three methods of Predator, GOR4, and SOPMA were used to detect A.hydrophila WQ PhaC Ah with R.eutrophaH16PhaC Re sequence for secondary structure prediction. Results: As the connecting peptide in the middle of the molecule, the random coil has a relatively loose structure, relatively small interaction, and extremely small rotation resistance around a single bond. Therefore, it does not have a unique three-dimensional structure and an optimal conformation, and is suitable as a connecting region.

[0112] 2) Using the biological analysis software Vector NTI 6.0 to compare the sequences of the two enzymes

[0113]

[0114] Results: Through sequence alignment and secondary structure prediction, the amino acid indicated in red, that is, the 159th amino acid of R.eutropha and the 154th ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant bacterium containing a novel PHA chimeric enzyme and a preparation method and application of the recombinant bacterium. The method comprises the following steps: by taking a PHA synthase gene phaCRe of oxygen-enriched alcaligenes and aWQ PHA synthase gene phaCAh of aeromonas hydrophila as parents, predicting secondary structures of PhaCRe and PhaCAh by utilizing a database, finding proper binding sites of two enzymes, and constructing the chimeric enzyme PhaCAhRe through SOE PCR. According to the method disclosed by the invention, the constructed chimeric enzyme PhaCAhRe can generate novel PHA by utilizing a proper carbon source, so that the yield of the PHA is increased, and the problem of single composition of a PHA monomer is solved. The invention provides a theoretical basis for constructing a chimeric enzyme for producing novel PHA by using a genetic engineering technology in future, provides a method for changing the monomer composition of PHA, and has certain value in promoting wider application of PHA.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a method for constructing novel PHA chimeric enzymes and recombinant bacteria containing the novel PHA chimeric enzymes through SOE-PCR. Background technique [0002] Polyhydroxyalkanonate (Polyhydroxyalkanonate, PHA) is a kind of granular polymer biopolyester produced by many microorganisms under the condition of sufficient carbon source and lack of nitrogen source, which can be used as carbon source and energy reserve in organisms. The diversity of structures makes PHA have many excellent properties such as thermoplasticity, biodegradability, biocompatibility, optical activity, piezoelectricity, gas barrier property, moisture resistance, low gas permeability, and mechanical properties. Because PHA has many properties, it has a wide range of applications in various fields, such as degradable packaging materials, pharmaceutical industry and tissue engineering. [0003] At presen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12N15/66C12N15/62C12P7/62
CPCC12N9/1029C12N15/70C12P7/625C07K2319/00
Inventor 胡风庆赵晓慧张卉妍王潘婷
Owner LIAONING UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com