O-GlcNAc glycosylation modified one-step enzyme labeling kit and application thereof

A kit and glycosylation technology, applied in the field of O-GlcNAc glycosylation modification one-step enzyme labeling kit, can solve the problems of low reproducibility and low reaction efficiency, and achieve good detection signal effect

Active Publication Date: 2021-05-28
ZHEJIANG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the literature reports that the second-step click chemistry reaction is inefficient and reproducible

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • O-GlcNAc glycosylation modified one-step enzyme labeling kit and application thereof
  • O-GlcNAc glycosylation modified one-step enzyme labeling kit and application thereof
  • O-GlcNAc glycosylation modified one-step enzyme labeling kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Preparation of bovine glycosyltransferase:

[0035] Expression strain construction: the company synthesized bovine glycosyltransferase GalT1 (NP_803478.1, 130-402 amino acids, pET23a, including the point mutation Y289L) gene vector, and transformed 100 μL of competent cells BL21 (DE3) with 10-50 ng of the plasmid. Place in ice bath for 30 minutes. Heat shock in a water bath at 42°C for 45 seconds, then quickly transfer the tube to ice and incubate for 2 minutes without shaking the centrifuge tube. Add 500 μL of sterile LB medium (without antibiotics) to each centrifuge tube, mix well, place at 37°C, 200 rpm, and recover for 2 hours. Paint the plate (amphicillin resistance), and incubate it upside down at 37°C for 12-24h. Pick monoclonal colonies. The GalT1-K279A protein carrier is obtained by point mutation on the basis of the GalT1 carrier. The primer sequences are:

[0036] F—AATGGATGCGTTTGGATTTAGCCTACCTTA

[0037] R—ATCCAAACGCATCCATTGCTACAGAAATGT

[0038]The p...

Embodiment 2

[0056] Example 2: Labeling O-GlcNAc glycosylation modification of cell lysate

[0057] (1) Collect HEK293T cells (6cm dish) by centrifugation at 4°C, 1000×g, add 300 μL of cell lysate (RIPA lysate: 50 mM Tris-HCl, pH=7.4, 150 mM NaCl, 0.1% SDS, 1×PIC protease Inhibitor mixed solution, 1mMPMSF), lysed at 4°C for 20min, centrifuged at 10000×g for 20min. The supernatant was taken, and the protein concentration was measured by BCA method.

[0058] (2) Take about 1.2 mg of protein, add 600 μL of methanol, 150 μL of dichloromethane and 400 μL of water in sequence, mix well (with white turbidity), 4 ° C, 10000 × g, centrifuge for 10 min, the white protein precipitate is in the middle, remove the upper layer solution, Add 450 μL of methanol, centrifuge to discard the supernatant, spin dry again, and evaporate the methanol to obtain a white protein precipitate.

[0059] (3) PNGase kit (NEB, P0704S) excised protein N-glycosylation modification. Dissolve the precipitated protein with ...

Embodiment 3

[0065] Example 3: Purification and omics identification of O-GlcNAc glycosylated modified protein in cell lysate

[0066] Label the cell lysate according to the operation of Example 2 (2 mg of protein per group, the reaction system is proportionally expanded), and then use streptavidin agarose resin to enrich the labeled protein, the specific operations are as follows:

[0067] (1) Take 50 μL of streptavidin agarose resin, centrifuge at 2000×g to remove the protective solution, then add 1 mL of binding buffer (100 mM Na 2 HPO 4 , 150mM NaCl, pH=7.2) wash the resin 3 times, add 1mL neutral salt solution (6% NP-40, 100mM NaCl 2 HPO 4 , 150mM NaCl): 1% SDS aqueous solution = 1:1 buffer, equilibrate the column once.

[0068] (2) For the protein that has been labeled, add 200 μL of 1% SDS aqueous solution to dissolve the protein precipitate, then add 200 μL of neutral salt solution, mix well, and centrifuge at 10000×g for 10 min. Take the supernatant, add it to the well-balance...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an O-GlcNAc glycosylation modified in-vitro detection kit. The kit mainly comprises a bovine-derived glycosyl transferase mutant solution, a modified sugar donor aqueous solution, a manganese chloride aqueous solution and a buffer solution. The kit can realize in-vitro efficient labeling of O-GlcNAc glycosylation modification, and the number of proteins obtained by one-step enzyme method enrichment and purification detected by mass spectrometry (LC-MS / MS) is about one time greater than the number of proteins identified by a two-step chemical enzyme method; in addition, the kit can also be applied to histological research of colon tumor samples.

Description

[0001] (1) Technical field [0002] The invention relates to a one-step enzyme labeling kit for O-GlcNAc glycosylation modification and application thereof. [0003] (2) Background technology [0004] Post-translational modification is an important factor that distinguishes mammals from lower organisms. Among them, glycosylation modification is a very complex chemical and biological process. The complexity of glycosylation modification is mainly related to two aspects: the diversity of monosaccharides and the diversity of individual monosaccharide linkages. At present, monosaccharide molecules have at least 5 chiral centers, and there are 9 basic monosaccharides in higher eukaryotes. These monosaccharide modules can be linked at different positions by glycosidic bonds in two (α or β) configurations. Linear or branched sugar chains can also undergo secondary modifications such as phosphorylation, sulfation or lipidation. The study of cellular glycosylation modification is cal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07H19/10C07H1/00G01N30/02G01N30/72G01N30/06G01N30/08G01N30/14C12Q1/48
CPCC07H19/10C07H1/00C12Q1/48G01N30/02G01N30/72G01N30/06G01N30/08G01N30/14G01N2333/91091G01N2030/067
Inventor吴李鸣易文田银平林丙义
OwnerZHEJIANG UNIV