Method for linking nucleic acid to protein or peptide
A technology for flexible linking of peptides and proteins, applied in chemical instruments and methods, biochemical equipment and methods, peptides, etc., can solve problems such as low non-covalent binding affinity, protein denaturation, and large environmental impact, and achieve simple reaction steps, The effect of short time consumption and mild reaction conditions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0081] Embodiment 1 Fusion and expression of SPG and topoI protein
[0082] In this embodiment, SPG (Streptococcus Protein G) is used as the target protein, and it is fused and expressed with topoI topoisomerase.
[0083] (1) Cloning of fusion protein: the nucleotide sequences of SPG and topoI were artificially synthesized. The nucleic acid sequence of SPG is shown in SEQ ID NO.4, and the nucleic acid sequence of topoI is shown in SEQ ID NO.2.
[0084] In this example, SPG and topoI topoisomerase are connected through a flexible linker peptide GGGGS to form a fusion protein, referred to as SPG-topoI, wherein the nucleotide sequence of the fusion protein SPG-topoI is shown in SEQ ID NO.5.
[0085] (2) Expression and purification of the fusion protein: the gene of the fusion protein SPG-topoI is cloned into the expression vector PET32a (the protein can be well expressed in various expression vectors and expression hosts, only the expression in Escherichia coli is described here...
Embodiment 2
[0086] The preparation of the complex that embodiment 2 SPG forms with nucleic acid
[0087] (1) SEQ ID NO.6: CGTGTCGCCCTTATTCCCATAGTGACTACAGC is mixed with the target nucleotide sequence shown in SEQ ID NO.7: GAATAAGGGCGACACG 1:1, and annealed to form a double strand. The annealing program is 80 degrees, 5 minutes; 55 degrees, 5 minutes ; 37 degrees for 3 minutes; obtain the double-strand recognition sequence;
[0088] (2) Mix the fusion protein SPG-topoI purified in Example 1 with the double-stranded phase obtained above, add magnesium ions with a final concentration of 1 mM, and react at 37°C for 30 minutes to obtain the protein-nucleic acid complex SPG-topoI - Nucleic acid.
[0089] (3) SDS-PAGE electrophoresis confirms that gained protein nucleic acid complex SPG-topoI-nucleic acid is confirmed, and its result is as follows figure 2 As shown, the channels from left to right in the figure represent respectively: 1 is the fusion protein control (control); 2 is the protei...
Embodiment 3
[0090] Example 3 Verification of Topo I-SPG-nucleic acid function
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
PatSnap Eureka turns technology decisions into work you can execute. Powered by our Innovation Knowledge Graph, it runs expert workflows across engineering, life sciences, materials and intellectual property. Get your review-ready output in minutes.
