Real-time PCR detection method for human group H rotavirus
A quantitative detection method and the technology of grouping rounds, applied in the field of microorganisms, can solve the problems that hinder the development of vaccine technology and the lack of detection methods in the epidemic situation of group H rotaviruses, and achieve convenient application, high detection sensitivity and specificity, and good specificity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] In order to realize the human H group rotavirus infection and culture of the passaged cells, firstly, the passaged cells are cultured. Passage cells include but are not limited to MA104 cells. The following takes human group H rotavirus J19 virus infection and culture of MA104 cells as an example to illustrate.
[0061] 1.1 Culture MA104 cells
[0062] 1.1.1 Recovery of cells
[0063] (1) Take out the required cell cryopreservation tube from the liquid nitrogen tank, put it into warm water at 37°C and shake it back and forth to melt it quickly, and centrifuge at 800rpm / min for 3min.
[0064] (2) Pour off the cell freezing solution.
[0065] (3) Prepare cell culture medium containing 10% FBS, that is, 1mL FBS+9mL1640, and the actual dosage is calculated according to the specific amount required for each experiment.
[0066] (4) Draw 6mL of cell culture solution into a 25cm 2 of cell flasks.
[0067] (5) at 25cm 2 Pipette 1mL of cell culture medium into the cell fl...
Embodiment 2
[0090] Example 2 Real-time PCR Quantitative Detection of Human Group H Rotavirus
[0091] 1. Preparation of RNA Standards
[0092] (1) Extraction of J19 virus RNA
[0093] Take 200 μl rotavirus J19 strain virus liquid, according to the QIAGEN company The viral RNA mini kit was operated according to the instructions, and the viral RNA genome was extracted and stored at -80°C.
[0094] (2) RT-PCR for one-step amplification of the target gene of the standard item
[0095] With primers SEQ ID NO:13 and SEQ ID NO:14, J19 viral RNA was subjected to one-step RT-PCR amplification, and the primer sequences are shown in Table 1. Amplify the VP6 gene fragment of Group H rotavirus J19 strain, the size is 657bp, and the primers were synthesized by Beijing Qingke Xinye Biotechnology Co., Ltd.
[0096] Table 1
[0097] Primer serial number Nucleotide sequence upstream primer SEQ ID NO: 13 ATGGAGCAGCAACTAGAACC downstream primer SEQ ID NO: 14 TACAACATTAGGTGG...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap