Recombinant plasmid combination, genetically modified saccharomycetes and method for producing odd-chain fatty acid

A technology for recombining plasmids and fatty acids, which is applied in the field of genetically modified yeast and the production of odd-chain fatty acids. It can solve the problems of high fermentation costs, difficulties in the production and ratio of odd-chain fatty acids, and achieve low fermentation costs.

Active Publication Date: 2021-06-11
BEIJING UNIV OF CHEM TECH
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Therefore, the technical problem to be solved by the present invention lies in the difficulty in increasing the production and ratio of odd-chain fatty acids in the microorganisms of the genetic engineering transformation in the prior art, and the defects that the fermentation cost is too high, and then provides a kind of recombinant plasmid for the synthesis of odd-number chain fatty acids Combination, genetically modified yeast and methods for producing odd chain fatty acids, starting from eukaryotic yeast, using recombinant plasmid combination to obtain intracellular enzyme expression regulated yeast through genetic engineering and establishing odd chains in microbial cells The synthesis pathway of chain fatty acids enables genetically engineered yeast to not only produce odd-chain fatty acids using propionic acid or non-propionic acid medium environment, but also to directly synthesize odd-chain fatty acids by using L-threonine and (or) glucose, and ferment Low cost, can further increase the production and ratio of odd chain fatty acids through genetic modification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant plasmid combination, genetically modified saccharomycetes and method for producing odd-chain fatty acid
  • Recombinant plasmid combination, genetically modified saccharomycetes and method for producing odd-chain fatty acid
  • Recombinant plasmid combination, genetically modified saccharomycetes and method for producing odd-chain fatty acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0171] Construction of embodiment 1 expression plasmid

[0172] (1) Construction of propionyl-CoA synthetase (prpE) expression plasmid Y33-prpE

[0173] The polynucleotide sequence (prpE) of propionyl-CoA synthetase of Salmonella enterica was selected for codon optimization, and the optimized polynucleotide sequence is shown in SEQ ID NO.1. After cutting the nucleotide sequence shown in SEQ ID NO.1 with SalI and XbaI, insert it into the vector Y33-PGKCYC (shown in SEQ ID NO.2) between SalI and XbaI restriction sites to obtain propionyl-CoA synthesis Enzyme expression plasmid Y33-prpE., its plasmid map is as follows figure 1 shown.

[0174] (2) Threonine deaminase (tdcB) expression plasmid Y22-tdcB construction

[0175] The threonine deaminase tdcB gene (NC_000913.3 (3265039..3266028), shown in SEQ ID NO.3) from Escherichia coli was selected for expression. Using the Escherichia coli genome as a template, polymerase chain reaction (PCR) was carried out with the following p...

Embodiment 2

[0214] Example 2 Construction of Aspartokinase, Homoserine Dehydrogenase and Threonine Synthetase Co-expression Plasmid Y33-thrABC

[0215] Aspartokinase, homoserine dehydrogenase and threonine synthase were all selected from Escherichia coli, and were composed of thrA(NC_000913.3(337..2799), thrB(NC_000913.3(2801..3733) and thrC (NC_000913.3 (3734..5020) encoding.

[0216] a. First construct the thrA expression plasmid

[0217] 1) Using the Escherichia coli genome as a template, carry out a PCR reaction with the following primers:

[0218] Primer ThrA-F (5'-3'):

[0219] TTATCTACTTTTTCACAAAATATAAAACAGTCGACATGCGAGTGTTGAAGTTCGGC;

[0220] Primer ThrA-R (5'-3'):

[0221] TGACATAACTAATTACATGATGCGGCCCTCTAGATCAGACTCCTAACTTCCATGAGAGG;

[0222] Table 13. PCR reaction system:

[0223] Element Volume (microliter) upstream primer 2.5 downstream primer 2.5 Template (E. coli genome) 0.5 5×Q5 Reaction Buffer 10 dNTPs (10mM) 1 Q5 DNA poly...

Embodiment 3

[0287] Example 3 Construction of aspartate kinase, aspartate aminotransferase and phosphoenolpyruvate carboxylase co-expression plasmid Y33-HOM3mu-ppc-aspC

[0288] Aspartate kinase is from Saccharomyces cerevisiae, encoded by HOM3 gene (NC_001137.3(256375..257958)); aspartate aminotransferase is from Escherichia coli, encoded by aspC gene (NC_000913.3(984519..985709)); Phosphoenolpyruvate carboxylase is from Escherichia coli and is encoded by the ppc gene (NC_000913.3(4150447..4153098)).

[0289] a. Construction of HOM3 expression plasmid Y33-HOM3mu

[0290] 1) Using the Saccharomyces cerevisiae genome as a template, carry out a PCR reaction with the following primers:

[0291] Primer HOM3-F (5'-3'):

[0292] CTACTTTTTTACAACAAATATAAAAACAGTCGACATGCCAATGGATTTCCAACCTA;

[0293] Primer HOM3-R (5'-3'):

[0294] TGACATAACTAATTACATGATGCGGCCCTCTAGATTAAATTCCAAGTCTTTTCAATTGT;

[0295] Table 25 PCR reaction system:

[0296] Element Volume (microliter) upstream pri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of eukaryotic saccharomycetes gene modification and fermentation, and provides a recombinant plasmid combination, genetically modified saccharomycetes and a method for producing odd-chain fatty acid, the recombinant plasmid combination comprises at least one expression plasmid; the expression plasmid comprises at least one polynucleotide encoding a polypeptide having threonine deaminase activity, fatty acid synthase activity, propionyl-CoA synthase activity, aldehyde dehydrogenase activity or keto acid decarboxylase activity; the recombinant plasmid combination can be used for carrying out genetic engineering modification on microorganisms, so that expression regulation of key enzymes can be carried out in the modified microorganisms to establish a synthetic route of odd-chain fatty acid, the odd-chain fatty acid can be directly synthesized by utilizing L-threonine and (or) glucose of propionic acid or non-propionic acid, the fermentation cost is low, and the yield and proportion of odd-chain fatty acid can be further improved by a gene modification method.

Description

technical field [0001] The invention relates to the field of eukaryotic yeast genetic modification and fermentation, in particular to a recombinant plasmid combination for odd-chain fatty acid synthesis, genetically modified yeast and a method for producing odd-chain fatty acids. Background technique [0002] Odd chain fatty acid (OCFA) functions similarly to unsaturated fatty acids and helps to improve the fluidity of cell membranes. The vast majority of fatty acids in nature are even-chain fatty acids, and odd-chain fatty acids are extremely rare, so odd-chain fatty acids are more valuable than conventional even-chain fatty acids. In terms of production, both chemical synthesis and natural extraction of odd-chain fatty acids are relatively difficult. The former is seriously polluted, and the latter is too expensive. The use of microorganisms to produce odd-chain fatty acids is an important way to solve the difficult problem of odd-chain fatty acid production. [0003] At...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/81C12N1/19C12P7/64C12R1/865
CPCC12N15/81C12P7/6409C12P7/6436C12P7/6463C12N9/88C12N9/1029C12N9/93C12N9/0008C12Y403/01019C12Y203/01085C12Y602/01036C12Y102/01C12Y401/01C12P7/64C12N1/16
Inventor史硕博孟琼宇丁文涛
OwnerBEIJING UNIV OF CHEM TECH