Ultrahigh-flux single cell sequencing method

A single-cell sequencing and cell technology, applied in the field of single-cell sequencing, can solve the problems of not easy portability, high sequencing cost, and expensive equipment.

Active Publication Date: 2021-07-13
ZHEJIANG UNIV
View PDF8 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the microfluidics-based sequencing platform cells are not tested in parallel, the batch effect problem is more significant, and there are disadvantages such as expensive equipment, not easy to carry, and high sequencing costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ultrahigh-flux single cell sequencing method
  • Ultrahigh-flux single cell sequencing method
  • Ultrahigh-flux single cell sequencing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] 1. Microplate preparation

[0056] According to the experimental scale (500,000 human 293T cells and 500,000 mouse 3T3 cells each), design the size of the microwell plate (the size of the well plate is 1.8cm×1.8cm), and etch the microwell on the silicon wafer as the initial mold, and the microwell is a cylinder Body shape, in which the depth of micropores is 60 μm, the diameter of micropores is 50 μm, and the distance between pores is 70 μm. Next pour polydimethylsiloxane (PDMS) on the silicon chip, take off PDMS after molding and become the second mold that has microcolumn on the plate, the microporous plate that final experiment uses is that concentration is 5% (mass ratio ) agarose (prepared with enzyme-free water), poured on the PDMS microcolumn plate after hot melting to condense and form, and the agarose plate at this time is a microporous plate with a certain thickness after being peeled off ( figure 1 ). When saving, add DPBS-EDTA mixture which is harmless to...

Embodiment 2

[0067] Human 293T, mouse 3T3 mixed cell test.

[0068] Add 5 million mouse embryonic stem cells (ESC) 3T3 and human embryonic kidney cells (293T) each 5 million slowly dropwise with 5-10ml methanol (-20°C pre-cooled) respectively, fix at -20°C for 30 minutes, and at the same time, aliquot the bridging primers 6.5 μl per well into eight tubes, then dispensed into a 96-well plate containing 0.5 μl reverse transcription primers, and left to mix to form a total of 1 μl reverse transcription mixed primers per well. The bridging primer sequence is 5'- CGTCGTGTAGGGAAAGAGTGT GACGCTGCCGACGA[ddC]-3', the 3' end is modified with ddC to prevent the extension of the bridging primer during reverse transcription and lead to the generation of by-products.

[0069] There are also 96 kinds of reverse transcription primers (reverse transcription sequences) and the above-mentioned cell label sequences, and the core sequence is 6×N. Each primer is placed independently in each well. This 6×N rand...

Embodiment 3

[0085] cDNA sequencing library construction.

[0086] (1) 5ng starting DNA fragmentation

[0087] Vazyme TD512 kit was used.

[0088] (a) Thaw 5×TTBL (TruePrep Tagment Buffer L) at room temperature, invert and mix well before use. Confirm that 5×TS (Terminate Solution, reaction termination solution) is at room temperature, and flick the tube wall to confirm whether there is precipitation. If there is precipitation, heat at 37°C and shake vigorously to mix well and the precipitation will dissolve.

[0089] (b) Add each reaction component in sequence in a sterilized PCR tube:

[0090] 5 × TTBL 4μl

[0091] DNA 5ng

[0092] TTE Mix V1 5μl

[0093] wxya 2 O to make up to 20 μl.

[0094] (c) Use a pipette to gently pipette 20 times to mix thoroughly.

[0095] (d) Put the PCR tube in the PCR instrument, and set the following reaction program: 55°C for 10 minutes; keep warm at 10°C.

[0096] (e) Immediately add 5 μl 5×TS to the reaction product, and mix well by gently blowi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Pore depthaaaaaaaaaa
Login to View More

Abstract

The invention discloses an ultrahigh-flux single-cell sequencing method, and the method comprises the following steps: by using molecular marker microspheres, a reverse transcription sequence and a bridging primer, carrying out primary intracellular reverse transcription in a cell by using the reverse transcription sequence; enabling one molecular marker microbead and one or more cells to be located in a separated space through a microwell plate technology or a micro-fluidic technology for the cells subjected to intracellular reverse transcription, splitting the cells under the action of a splitting solution, and connecting a sequence obtained after reverse transcription with a molecular marker sequence on the molecular marker microbead with the help of a bridging primer; obtaining a large number of sequences through PCR amplification, constructing and obtaining a cDNA sequencing library, and carrying out high-throughput sequencing, wherein specific transcriptome information of millions of single cells can be obtained through one-time sequencing. The single cell sequencing flux is greatly improved.

Description

technical field [0001] The invention relates to the technical field of single-cell sequencing, in particular to an ultra-high-throughput single-cell sequencing method. Background technique [0002] Since Tang Fuchou proposed single-cell sequencing technology in 2009, single-cell high-throughput sequencing platforms have sprung up like mushrooms after rain, such as Microfluidic-based Drop-seq (Macosko, E.Z., et al., Highly ParallelGenome- wide Expression Profiling of Individual Cells Using NanoliterDroplets. Cell, 2015.161(5): p.1202-1214.) and inDrop-seq (Klein, Allon M., et al., Droplet Barcoding for Single-Cell Transcriptomics Applied to Embryonic StemCells. Cell, 2015.161(5): p.1187-1201.) platform, Microwell-seq based on microwell plates (Han, X., et al., Mapping the Mouse Cell Atlas by Microwell-Seq. Cell, 2018.173( 5): p.1307.) and Seq-well (Gierahn, T.M., et al., Seq-Well: portable, low-cost RNAsequencing of single cells at high throughput. Nat Methods, 2017.14(4): p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6869C12N15/11
CPCC12Q1/6869C12Q2535/122C12Q2563/155C12Q2521/107
Inventor郭国骥廖原陈海德韩晓平王晶晶
OwnerZHEJIANG UNIV