Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CRISPR-Cas13a isothermal detection primer group for detecting Taura syndrome virus and application of CRISPR-Cas13a isothermal detection primer group

A technology for detecting primers and syndromes, applied in the field of biotechnology detection, can solve problems such as being unsuitable for rapid screening at the grassroots level, time-consuming, and complicated to operate.

Inactive Publication Date: 2021-07-30
HANGZHOU ALLSHENG INSTR +2
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, pathological microscope observation, biochemical assay, immunological test, cell culture, PCR and liquid chip technology are usually used to detect whether shrimp is infected with Taura syndrome virus, etc., but these methods are cumbersome, time-consuming, and expensive. There are many difficulties in the practical application of farms, it is difficult to meet the current needs of rapid and accurate detection, and it is not suitable for rapid screening at the grassroots level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR-Cas13a isothermal detection primer group for detecting Taura syndrome virus and application of CRISPR-Cas13a isothermal detection primer group
  • CRISPR-Cas13a isothermal detection primer group for detecting Taura syndrome virus and application of CRISPR-Cas13a isothermal detection primer group
  • CRISPR-Cas13a isothermal detection primer group for detecting Taura syndrome virus and application of CRISPR-Cas13a isothermal detection primer group

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] 1. RNA standard preparation and crRNA preparation of TSV

[0047] 1.1 Standard preparation of TSV

[0048] The TSV gene (GENBANK: AF277675.1) sequence was inserted between HindⅢ and BamHI of the PUC-57 plasmid to obtain the PUC-57-TSV plasmid. Using the PUC-57-TSV plasmid (entrusted to Anhui General Synthesis) as a template, the primers Add the T7 promoter at the 5' end of the upstream primer when designing, and design the primers as follows:

[0049] TSV-F: TAATACGACTCACTATAGGGCCTCAGGCAACGAA;

[0050] TSV-R: ATTCCAGAGCTTCACAAGGGAAATTCTCAT.

[0051] Prepare PCR amplification reagents according to Table 1 below.

[0052] Table 1

[0053] Reagent Sample volume TSV-F (10μM) 2μL TSV-R (10μM) 2μL Fast PCR Master Mix (Takara) 10 μL wxya 2 o

to a total volume of 20 μL

[0054] The amplified PCR product was purified and recovered, and T7 was transcribed using the T7 High Yield RNA Transcription Kit (Nanjing Nuoweizan), and th...

Embodiment 2

[0098] 1. Experimental materials

[0099] Sample 1: No. XS01, Litopenaeus vannamei shrimp seedlings, provided by Zhejiang Provincial Aquatic Technology Extension Station;

[0100] Sample 2: No. XS02, Litopenaeus vannamei seedlings, provided by Zhejiang Provincial Aquatic Technology Extension Station;

[0101] Sample 3: No. XS03, Litopenaeus vannamei shrimp seedlings, provided by Zhejiang Provincial Aquatic Technology Extension Station;

[0102] Sample 4: No. XS04, Litopenaeus vannamei shrimp seedlings, provided by Zhejiang Provincial Aquatic Technology Extension Station;

[0103] Sample 5: No. XS05, Litopenaeus vannamei shrimp seedlings, provided by Zhejiang Provincial Aquaculture Technology Extension Station;

[0104] Sample 6: No. XS06, Litopenaeus vannamei shrimp seedlings, provided by Zhejiang Provincial Aquatic Technology Extension Station.

[0105] 2. Extraction of Shrimp Taura Syndrome Virus (TSV) RNA

[0106] (1) Weigh 30 mg of the experimental sample. Since the ac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a CRISPR-Cas13a (clustered regularly interspaced short palindromic repeats-associated 13a) isothermal detection primer group for detecting Taura syndrome virus and application of the CRISPR-Cas13a isothermal detection primer group. The CRISPR-Cas13a isothermal detection primer group comprises a crRNA group and an RNA probe, the crRNA group comprises three pieces of crRNA, the three pieces of crRNA are respectively named as TSV-crRNA3, TSV-crRNA5 and TSV-crRNA7, and the RNA probe is named as TSV-Probe. The method is simple and rapid in detection operation and suitable for field detection; the specificity is high; the detection sensitivity is high and can reach 10 < 2 > copy / reaction; the method is high in accuracy and reliable, and has a wide application prospect.

Description

technical field [0001] The invention relates to the technical field of biotechnology detection, in particular to a CRISPR-Cas13a isothermal detection primer set for detecting Taura syndrome virus and its application. Background technique [0002] Shrimp Taura syndrome, commonly known as "red tail disease", is a serious contagious shrimp disease caused by Taura syndrome virus (TSV). The acute stage of symptoms is characterized by reddened shrimp body and soft shell, and the transitional stage is characterized by irregular blackening of horny epithelium. [0003] Taura syndrome virus (Taura syndrome virus, TSV) is a non-enveloped single-stranded positive-sense RNA virus with a diameter of 31-32nm. It belongs to the small RNA virus family and its main host is Penaeus prawn. Infection of crustacean epithelium (such as appendages, gills, stomach, esophagus, hindgut), connective tissue, etc., causing sick shrimp not to eat, no food in the digestive tract; swimming weakness, unres...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844C12Q2531/119C12Q2521/301C12Q2527/127
Inventor 黄俊张徐俞李业杨稳付媛媛朱凝瑜郑晓叶俞晓平骆志成樊伟东
Owner HANGZHOU ALLSHENG INSTR
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com