Check patentability & draft patents in minutes with Patsnap Eureka AI!

Preparation and method of biosensor for detecting concentration of hot calcium in milk produced by dairy cow

A biosensor and detection method technology, applied in the field of biosensors, can solve the problems of inaccurate precision, dairy cow disease, and insufficient method of blood calcium monitoring, etc., and achieve the effect of high precision and fast detection speed

Inactive Publication Date: 2021-09-07
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

And the minimum value of blood calcium concentration generally appears in postpartum 12 to 24h, so the monitoring of blood calcium of cows collected in this time period can better reflect the degree of hypocalcemia of dairy cows; The accuracy is not accurate enough, and the method for blood calcium monitoring is not perfect, which will easily lead to subsequent dairy cow diseases due to the unfavorable monitoring of low blood calcium, which will have a great impact on production. Therefore, it is urgent to develop a method for the detection and monitoring of blood calcium concentration in dairy cows. Optimization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation and method of biosensor for detecting concentration of hot calcium in milk produced by dairy cow
  • Preparation and method of biosensor for detecting concentration of hot calcium in milk produced by dairy cow
  • Preparation and method of biosensor for detecting concentration of hot calcium in milk produced by dairy cow

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0038] The specific implementation manner of the present invention will be further described below in conjunction with the accompanying drawings.

[0039] dna sequence

[0040] Ca_substrate:

[0041] NH 2 -(CH 2 ) 6 GCGGTAGAAGG / rA / TATCACTGAGCACTGGG / rA / TAAGCGGTAGAACTCACAATGTATAATGCGCGCATTATACATTGTGAGT

[0042] Cazyme:

[0043] TCTACCGCTTTGTTGGAATGGCTCATGCCACACTCTTCAGTGCTCAGTGATTGTTGGAATGGCTCATGCCACACTCTTTTCTACCGC.

[0044] A preparation of a biosensor for detecting calcium concentration of milk production heat of dairy cows, comprising the following steps: refer to the attached figure 2 step chart;

[0045] (1) Carboxylation process of single-walled carbon nanotubes (SWNTs): place single-walled carbon nanotubes in a mixed solution of concentrated nitric acid and concentrated sulfuric acid with a volume ratio of 1:3 for 6 hours; rinse with enough Milli-Q purified water SWNT until the pH of the water reaches neutral; put the treated SWNT into a vacuum furnace and heat at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of a biosensor for detecting the concentration of hot calcium in milk produced by a dairy cow. The preparation method comprises the following steps: carboxylation of a single-walled carbon nanotube (SWNT): placing the single-walled carbon nanotube in a mixed solution of concentrated nitric acid and concentrated sulfuric acid in a volume ratio of 1: 3 for 6 hours; washing the SWNT with enough Milli-Q purified water until the pH value of the water is neutral; putting the treated SWNT into a vacuum furnace, and heating for 60 minutes at the temperature of 80 DEG C; dissolving 1 mg of SWNT and performing ultrasonic treatment to uniformly disperse into 2 mL of a dimethylformamide solution. The biosensor disclosed by the invention has the advantages that by using the biosensor disclosed by the invention, the milk cow blood calcium content can be effectively detected, and compared with the existing milk cow blood calcium detection method, the biosensor disclosed by the invention has the advantages of high precision and high detection speed, provides powerful data reference for monitoring diseases such as milk cow rumen air blowing, abomasal displacement, endometritis and mastitis caused in production. The blood calcium content of the dairy cow can be effectively monitored for a long time by using the biosensor.

Description

technical field [0001] The invention relates to the field of biosensors, in particular to a preparation and method of a biosensor for detecting the calcium concentration of cow milk production heat. Background technique [0002] Calcium has many physiological functions such as blood coagulation, nerve conduction, cell membrane permeability, muscle contraction, enzyme activity, and hormone release in the life process of animals. During the peripartum period, dairy cows will transition from the non-lactating stage to the lactating stage, and the calcium in the body will change from the fetus to the mammary gland, facing huge changes in terms of physiology, digestion, and metabolism. Before parturition, dairy cows only need to take in about 30g of calcium per day (15g of feces and urine loss and 15g of fetal development), which can be absorbed through the gastrointestinal tract to meet the needs; after parturition, a large amount of lactation leads to a large loss of blood calc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N27/327G01N27/38
CPCG01N27/3275G01N27/38
Inventor 王辉熊本海杨亮戴鼎震石芳权
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More