A kind of Trichoderma reesei cbh1 gene promoter mutant and its construction method and application
A Trichoderma reesei and promoter technology, applied in the direction of microbial-based methods, applications, genetic engineering, etc., to achieve significant effects, high-efficiency expression, and improved production levels
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1 The amplification of the promoter's mutant fragment
[0051] Select the 5 ′ upstream-829bp to -1bp sequence of the 5 ′ upstream of the CBH1 of the Li's wooden fibrous glycogen enzyme. It is defined as the promoter PCBH1. The nucleotide sequence is shown in SEQ ID NO.1.Replace the XYR1 binding site in the CBH1 promoter-829bp to the XYR1 binding site with a stronger combination ability of other promoter sources, including XYN1, EGL1 promoter's XYR1 binding site, and remove the binding of the inhibitory factor CRE1Siter, specific operation as -824bp to -774bp GGCTAAGCCCCCAgCAgCAgcgcgcgcgcgcgcgcgcgCACACACACACACACCCC of Nucleotide sequences; convert the -737bp of nucleotides;
[0052] In addition, it is also designed to synthesize the promoter PCBH1XDC-2. In addition to the above-mentioned sequence features containing the PCBH1XDC-1, it also replaced PCBH1 -206bp to -175bp TTAGCCAAACAACCCCCCCCCCCCCCCCCCCCCC to GGCTAAAAATGACGACACACTAGCC and replace the A148BP A.The nucl...
Embodiment 2
[0065] Example 2 uses the construction of an expression box expressed by the promoter mutant driver β-mannose enzyme expression
[0066]Construction of PM5P carrier: Use the PM5P particle carrier to build a gene expression box from β-mannidinase Man5A from oxalic acid, which is EPS31069.1.The map of the PM5P carrier such as figure 1 It shows that the upstream sequence (PYR4 UPSTREAM) and the downstream sequence (PYR4DOWNSTREAM) of the Pyr4 gene of the PYR4 gene, there are Man5A genes from oxalic acid green mold and its terminal TMAN, as well as being used for screening labels.Nucleoside 5′-de-carboxyrase encoded gene PYRG.Between the upstream sequence of PYR4 and the MAN5A gene sequence, the enzyme cutting sequence of ECO72i is introduced.
[0067] Using restricted intrase enzyme ECO72i enzyme cutting pm5P, using one-step cloning kar for single segments and multi-fragment cloning, respectively different starter fragments PCBH1, PCBH1XDC-1, PCBH1XDC-2 and PC_IR-DI_Z-IR.PM5P plasmid...
Embodiment 3
[0068] Example 3 uses the building of the strain expressed by the promoter mutant drive β-mannose enzyme
[0069] Using the native body conversion method, the MAN5A gene expression box obtained by Example 2 is converted into the QP4 strain, respectively.The upstream sequence and downstream sequence of the PYR4 gene at both ends of the expression box are used as homologous arm, and the expression box is integrated at the PYR4 gene site through homologous reorganization.
[0070] The preparation method of the native body is:
[0071] 1. 10 PDA medium tablets containing 0.1 % (W / V) acuraine, and use a tweeter to pinch a single -layer glass paper to cover the surface of the PDA medium.Take 80 μL of fresh spore suspension on the glass paper, and coat it evenly with the coating rod to avoid producing bubbles.Use a sealing film to seal the medium tablet to avoid pollution.Set at 30 ° C culture box 16h.
[0072] 2. In the ultra -Taichung, it is said to be dissolved in the buffer S1 ( / L:21...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap