A kind of Trichoderma reesei cbh1 gene promoter mutant and its construction method and application

A Trichoderma reesei and promoter technology, applied in the direction of microbial-based methods, applications, genetic engineering, etc., to achieve significant effects, high-efficiency expression, and improved production levels

Active Publication Date: 2022-06-14
SHANDONG UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the production of β-mannanase in Trichoderma reesei expression host still needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Trichoderma reesei cbh1 gene promoter mutant and its construction method and application
  • A kind of Trichoderma reesei cbh1 gene promoter mutant and its construction method and application
  • A kind of Trichoderma reesei cbh1 gene promoter mutant and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 The amplification of the promoter's mutant fragment

[0051] Select the 5 ′ upstream-829bp to -1bp sequence of the 5 ′ upstream of the CBH1 of the Li's wooden fibrous glycogen enzyme. It is defined as the promoter PCBH1. The nucleotide sequence is shown in SEQ ID NO.1.Replace the XYR1 binding site in the CBH1 promoter-829bp to the XYR1 binding site with a stronger combination ability of other promoter sources, including XYN1, EGL1 promoter's XYR1 binding site, and remove the binding of the inhibitory factor CRE1Siter, specific operation as -824bp to -774bp GGCTAAGCCCCCAgCAgCAgcgcgcgcgcgcgcgcgcgCACACACACACACACCCC of Nucleotide sequences; convert the -737bp of nucleotides;

[0052] In addition, it is also designed to synthesize the promoter PCBH1XDC-2. In addition to the above-mentioned sequence features containing the PCBH1XDC-1, it also replaced PCBH1 -206bp to -175bp TTAGCCAAACAACCCCCCCCCCCCCCCCCCCCCC to GGCTAAAAATGACGACACACTAGCC and replace the A148BP A.The nucl...

Embodiment 2

[0065] Example 2 uses the construction of an expression box expressed by the promoter mutant driver β-mannose enzyme expression

[0066]Construction of PM5P carrier: Use the PM5P particle carrier to build a gene expression box from β-mannidinase Man5A from oxalic acid, which is EPS31069.1.The map of the PM5P carrier such as figure 1 It shows that the upstream sequence (PYR4 UPSTREAM) and the downstream sequence (PYR4DOWNSTREAM) of the Pyr4 gene of the PYR4 gene, there are Man5A genes from oxalic acid green mold and its terminal TMAN, as well as being used for screening labels.Nucleoside 5′-de-carboxyrase encoded gene PYRG.Between the upstream sequence of PYR4 and the MAN5A gene sequence, the enzyme cutting sequence of ECO72i is introduced.

[0067] Using restricted intrase enzyme ECO72i enzyme cutting pm5P, using one-step cloning kar for single segments and multi-fragment cloning, respectively different starter fragments PCBH1, PCBH1XDC-1, PCBH1XDC-2 and PC_IR-DI_Z-IR.PM5P plasmid...

Embodiment 3

[0068] Example 3 uses the building of the strain expressed by the promoter mutant drive β-mannose enzyme

[0069] Using the native body conversion method, the MAN5A gene expression box obtained by Example 2 is converted into the QP4 strain, respectively.The upstream sequence and downstream sequence of the PYR4 gene at both ends of the expression box are used as homologous arm, and the expression box is integrated at the PYR4 gene site through homologous reorganization.

[0070] The preparation method of the native body is:

[0071] 1. 10 PDA medium tablets containing 0.1 % (W / V) acuraine, and use a tweeter to pinch a single -layer glass paper to cover the surface of the PDA medium.Take 80 μL of fresh spore suspension on the glass paper, and coat it evenly with the coating rod to avoid producing bubbles.Use a sealing film to seal the medium tablet to avoid pollution.Set at 30 ° C culture box 16h.

[0072] 2. In the ultra -Taichung, it is said to be dissolved in the buffer S1 ( / L:21...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a Trichoderma reesei cbh1 gene promoter mutant and its construction method and application, belonging to the technical field of genetic engineering; the Trichoderma reesei cbh1 gene promoter mutant provided by the invention has a nucleotide sequence such as SEQ ID No .2 shown. The present invention also provides a recombinant strain of Trichoderma reesei, which contains the above-mentioned Trichoderma reesei cbh1 gene promoter mutant. The Trichoderma reesei cbh1 gene promoter mutant constructed by the present invention can improve the effect of driving the expression of β-mannanase, and the expression of the β-mannanase constructed by the Trichoderma reesei cbh1 gene promoter mutant of the present invention can be improved The strain can significantly increase the production of β-mannanase.

Description

Technical field [0001] The present invention involves the field of genetic engineering technology, especially the CBH1 gene promoter and its construction methods and applications of the CBH1 gene. Background technique [0002] Silk -shaped fungi has powerful protein synthetic secretion capabilities, is widely used in the production of industrial enzymes, and has good application prospects in the production of pharmaceutical protein.Trichoderma Reesei is the main microorganism of cellulose enzymes. Its extracellular protein output can reach 80g / L.This enzyme -encoded gene is the first choice for the expression of restructuring protein in the driver of Woodwood. [0003] The expression of fibrinase in Li's at is regulated by a combination of multiple transcription factors.Among them, XYR1 is a key transcriptional activation factor, and carbon decomposition metabolic suppress factor CRE1 has a significant negative regulatory effect.In addition, the transcription factor ACE2, ACE3, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/80C12N15/67C12N15/56C12N1/15C12N9/42C12R1/885
CPCC12N9/2437C12N15/80C12N9/2494C12Y302/01078C12Y302/01091C12N2830/002
Inventor 刘国栋姜珊珊赵芹芹王悦刘琴曲音波
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap