Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant coccidiosis vector for expressing NA4 protein and fluorescent label and detection method of recombinant coccidiosis vector

A fluorescent label and detection method technology, applied in the field of gene editing, can solve the problems of unsatisfactory immune effect of Eimeria attenuated live vaccine and difficulty in establishing immune protection, so as to achieve stability, heritability, and gene editing efficiency High, editing-efficient effects

Pending Publication Date: 2022-03-15
FOSHAN STANDARD BIO TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the common way to prevent coccidiosis in the domestic market is to use polyvalent attenuated live vaccines to immunize with drinking water or spices, but the immune effect of poisoned Eimeria attenuated live vaccines is not ideal, and it is difficult to establish immune protection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant coccidiosis vector for expressing NA4 protein and fluorescent label and detection method of recombinant coccidiosis vector
  • Recombinant coccidiosis vector for expressing NA4 protein and fluorescent label and detection method of recombinant coccidiosis vector
  • Recombinant coccidiosis vector for expressing NA4 protein and fluorescent label and detection method of recombinant coccidiosis vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] This embodiment provides a sgRNA targeting the ETH_00009555 gene, the nucleotide sequence of the sgRNA is shown in SEQ ID No.1.

[0086] SEQ ID No. 1: aataggccgaccagacggtg.

[0087]In the present invention, the sgRNA targets the non-coding region sequence of the ETH_00009555 gene, and the sgRNA has good specificity and targeting, low off-target rate, and high editing efficiency.

Embodiment 2

[0089] This embodiment provides an ETH_00009555 gene editing system, the ETH_00009555 gene editing system includes sgRNA targeting the ETH_00009555 gene, Cas9 and homologous recombination fragments.

[0090] The sgRNA targeting the ETH_00009555 gene is connected to the Cas9 in the same gene editing plasmid.

[0091] The homologous recombination fragment includes the 5' homology arm of the ETH_00009555 gene, the SAG13 promoter, the NA4 gene, mCherry red fluorescent protein, the SAG13 terminator and the 3' homology arm of the ETH_00009555 gene.

[0092] The ETH_00009555 gene editing system can insert the NA4 gene of poisonous Eimeria into the ETH_00009555 gene of Eimeria tenella, avoiding non-specific gene editing, high editing efficiency and low off-target rate.

Embodiment 3

[0094] This embodiment provides a recombinant coccidia vector, the recombinant coccidia vector is edited by the ETH_00009555 gene editing system in Example 2, and the NA4 gene that poisons Eimeria coccidia is inserted into the ETH_00009555 gene at a fixed point coccidia.

[0095] The recombinant coccidian vector is constructed by the following method:

[0096] (1) Construction of a gene editing plasmid containing sgRNA targeting the ETH_00009555 gene and Cas9:

[0097] The non-coding region of the ETH_00009555 gene was selected as the insertion site, and the nucleotide sequence of the site is shown in SEQ ID No.4.

[0098] SEQ ID No.4:

[0099] tgtgggcagaaagagggcggcgtagagaggcatttagtggatgcttttgaggagttctgggaggtcatcagtagtggggaaggtctaccgcaccgtctggtcggccttattagttaatgcccacatgaggcgatcttttggtggtgcgtgacggggtcagtcattgga.

[0100] Utilize Q5 point mutation kit to carry out PCR reaction, the nucleotide sequence of forward primer sequence sgACTIN F is shown in SEQID No.5, the nucleotide...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant coccidiosis vector for expressing NA4 protein and a fluorescent label and a detection method of the recombinant coccidiosis vector, and belongs to the technical field of genetic engineering. The invention provides sgRNA (small guide ribonucleic acid) targeting an ETH00009555 gene, and the sgRNA can be used for carrying out accurate gene site-directed mutagenesis; a gene editing system is established by sgRNA, Cas9 and homologous recombination fragments, homologous fragments such as NA4 protein and fluorescent label protein of eimeria poisoning can be accurately recombined to an ETH00009555 gene in a homologous manner, and a recombinant coccidium vector for expressing the NA4 protein and a fluorescent label is constructed. The DNA of the recombinant coccidiosis vector is subjected to PCR (Polymerase Chain Reaction) detection and sequencing, and the result shows that the recombinant coccidiosis vector is successfully recombined to the ETH00009555 gene; and the recombinant coccidiosis vector has an obvious fluorescence signal under a fluorescence microscope, which indicates that the recombinant coccidiosis vector successfully expresses the NA4 protein and the fluorescence tag protein.

Description

technical field [0001] The invention belongs to the technical field of gene editing, and in particular relates to a recombinant coccidian vector expressing NA4 protein and a fluorescent label and a detection method thereof. Background technique [0002] Toxic Eimeria necatrix can cause acute small intestinal coccidiosis in 9-14-week-old hens and breeders, not only invading the middle of the small intestine, but also causing expansion and thickening of the small intestinal wall, local superficial tissue and Severe damage to the deep mucosa seriously affects the absorption function of the intestine, and at the same time causes damage to the cecal mucosa, showing a moderate inflammatory response. Because there is no cross-immunity between chicken coccidia species, chickens infected with Eimeria tenella will also cause secondary coccidiosis outbreaks in the same chicken group when they are infected by poisonous Eimeria coccidiosis. Farmers bring secondary losses. [0003] Pate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N9/22C12N15/12C12N15/65C12N15/85C12N15/90C12Q1/686G01N21/64
CPCC12N15/113C12N9/22C07K14/455C12N15/65C12N15/85C12N15/902C12Q1/686G01N21/6428C12N2310/20C12Q2521/107C12Q2563/107
Inventor 翁亚彪蔡晓懿周德荣林瑞庆陆肖谭志坚刘丽丹王新秋
Owner FOSHAN STANDARD BIO TECH