Recombinant coccidiosis vector for expressing NA4 protein and fluorescent label and detection method of recombinant coccidiosis vector
A fluorescent label and detection method technology, applied in the field of gene editing, can solve the problems of unsatisfactory immune effect of Eimeria attenuated live vaccine and difficulty in establishing immune protection, so as to achieve stability, heritability, and gene editing efficiency High, editing-efficient effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0085] This embodiment provides a sgRNA targeting the ETH_00009555 gene, the nucleotide sequence of the sgRNA is shown in SEQ ID No.1.
[0086] SEQ ID No. 1: aataggccgaccagacggtg.
[0087]In the present invention, the sgRNA targets the non-coding region sequence of the ETH_00009555 gene, and the sgRNA has good specificity and targeting, low off-target rate, and high editing efficiency.
Embodiment 2
[0089] This embodiment provides an ETH_00009555 gene editing system, the ETH_00009555 gene editing system includes sgRNA targeting the ETH_00009555 gene, Cas9 and homologous recombination fragments.
[0090] The sgRNA targeting the ETH_00009555 gene is connected to the Cas9 in the same gene editing plasmid.
[0091] The homologous recombination fragment includes the 5' homology arm of the ETH_00009555 gene, the SAG13 promoter, the NA4 gene, mCherry red fluorescent protein, the SAG13 terminator and the 3' homology arm of the ETH_00009555 gene.
[0092] The ETH_00009555 gene editing system can insert the NA4 gene of poisonous Eimeria into the ETH_00009555 gene of Eimeria tenella, avoiding non-specific gene editing, high editing efficiency and low off-target rate.
Embodiment 3
[0094] This embodiment provides a recombinant coccidia vector, the recombinant coccidia vector is edited by the ETH_00009555 gene editing system in Example 2, and the NA4 gene that poisons Eimeria coccidia is inserted into the ETH_00009555 gene at a fixed point coccidia.
[0095] The recombinant coccidian vector is constructed by the following method:
[0096] (1) Construction of a gene editing plasmid containing sgRNA targeting the ETH_00009555 gene and Cas9:
[0097] The non-coding region of the ETH_00009555 gene was selected as the insertion site, and the nucleotide sequence of the site is shown in SEQ ID No.4.
[0098] SEQ ID No.4:
[0099] tgtgggcagaaagagggcggcgtagagaggcatttagtggatgcttttgaggagttctgggaggtcatcagtagtggggaaggtctaccgcaccgtctggtcggccttattagttaatgcccacatgaggcgatcttttggtggtgcgtgacggggtcagtcattgga.
[0100] Utilize Q5 point mutation kit to carry out PCR reaction, the nucleotide sequence of forward primer sequence sgACTIN F is shown in SEQID No.5, the nucleotide...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


