Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for rapidly evaluating canker resistance of citrus variety

A technology for citrus and varieties, applied in the field of rapid assessment of citrus varieties' resistance to canker disease, can solve time-consuming and labor-intensive problems, reduce costs and labor, and improve resistance

Pending Publication Date: 2022-04-22
GANNAN NORMAL UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Specifically, the bacterial concentration is determined by measuring the bacterial growth on a plate, but this method is time-consuming and laborious. Therefore, it is urgent to establish a rapid evaluation method for the resistance of citrus germplasm resources to canker.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly evaluating canker resistance of citrus variety
  • Method for rapidly evaluating canker resistance of citrus variety
  • Method for rapidly evaluating canker resistance of citrus variety

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The construction of embodiment 1 enhanced yellow-green fluorescent protein (eYFP) plasmid and Xcc-eYFP strain

[0039] 1. Method

[0040] The eYFP coding region (SEQ ID NO.1):

[0041] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtga;克隆到pBBR1-MCS5质粒中,构建了广域宿主的载体pBBR1-eYFP。 The recombinant plasmid of pBBR1-eYFP w...

Embodiment 2

[0045] The comparison of embodiment 2 routine and fluorescent spot counting method measuring Xcc

[0046] Using plate dilution counting method on the culture medium is a common method to determine the amount of bacterial growth, but this method is time-consuming and laborious. The purpose of the present invention is to simplify and speed up the quantification of Xcc by counting the fluorescence amount of Xcc-eYFP using a fluorescence microscope. To verify the accuracy of the method, we quantified Xcc-eYFP extracted from infected leaves by conventional electroplating and fluorescent spot counting methods. Xcc-eYFP was extracted from inoculated Hamlin sweet orange leaves at 1, 3, 5, 7, and 9 days post-inoculation (dpi). Both methods observed similar bacterial concentrations of Xcc-eYFP at all time points (e.g. Figure 4 Shown), indicating that the accuracy of the fluorescent spot counting method is consistent with the traditional plate colony counting method. Secondly, the st...

Embodiment 3

[0047] Example 3 Using Xcc-eYFP to assess the susceptibility of citrus varieties to canker

[0048] Set the concentration to 5 x 10 8 cfu / mL of Xcc-eYFP and Xcc were inoculated on 20 citrus varieties, including 18 wild citrus accessions (Table 1). Similar symptoms were observed on citrus varieties inoculated with Xcc-eYFP and Xcc (eg Figure 5 shown). Among the 20 citrus varieties, Dali citron, Yiliang citron, Yichang orange, Huapi kumquat, Longyan kumquat, Bawang kumquat and Daoxian wild orange showed no or significantly reduced ulcer symptoms. On the contrary, Pingbian wild sweet orange, Jianshui orange, Longmen lemon, Chongyi wild orange, Mangshan wild orange, Jiangjin lime, Kalizuo orange, Ledong kumquat, wasp orange, Honghe orange, Mengla sour pomelo Hechenggu wild pomelo showed typical ulcer disease symptoms.

[0049] According to the growth of Xcc-eYFP and Xcc in plants, the bacterial concentrations in Dali citron, Yiliang citron, Yichang orange, Huapi kumquat and B...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapidly evaluating canker resistance of a citrus variety, which comprises the following steps: firstly, constructing enhanced yellow fluorescent protein labeled citrus xanthomonas, then injecting or spraying and inoculating a fluorescence labeled citrus xanthomonas suspension to the leaf backs of the citrus variety to be evaluated, culturing in a greenhouse, taking leaves, grinding, and screening to obtain the canker resistance of the citrus variety. And observing the grinding liquid under a fluorescence microscope, counting fluorescence spots, calculating the growth change of bacteria, and evaluating the canker resistance. Researches show that enhancement of yellow fluorescent protein (eYFP) does not affect growth and toxicity of Xanthomonas citri (Xcc), and eYFP labeled Xcc can be successfully used for quantifying bacterial concentration and evaluating canker resistance of citrus, is faster and more effective than a plate colony counting method, has consistency with wild Xanthomonas citri, and can be used for detecting canker resistance of citrus. The canker resistance of the citrus variety can be rapidly evaluated.

Description

technical field [0001] The invention relates to the technical field of plant disease resistance evaluation, in particular to a method for rapidly evaluating the resistance of citrus varieties to canker disease. Background technique [0002] Citrus is one of the three most important commercial fruit crops in the world. Citrus canker (CBC) is one of the most devastating bacterial diseases, causing severe defoliation of citrus plants, damaged fruit, and premature fruit shedding, thereby reducing citrus quality and yield. The pathogen of citrus canker is the Gram-negative bacterium Xanthomonas citri (Xcc), which is divided into several pathogenic types (A, A w and A*, B, and C). Among them, Asian pathogenicity (XccA) is widespread in the world, and most economic citrus varieties are susceptible to its infection. XccA infects citrus leaves, stems and fruits through natural openings such as stomata and wounds. Young leaves are more susceptible than mature leaves. In addition,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12N15/12C12Q1/18C12R1/64
CPCC07K14/43595C12N15/74C12Q1/18G01N2333/195
Inventor 鲍敏丽段硕龙云飞
Owner GANNAN NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com