Gene expression regulation system and application thereof

A gene expression and effector protein technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve problems such as unexpected changes in the host genome, complex structure of type I systems, etc., and achieve the effect of broad application prospects

Active Publication Date: 2022-06-03
SOUTH CHINA AGRI UNIV
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the complex structure of the type I system, the current method of expressing the type I system in a heterologous bacterial host for gene transcription repression requires integrating the entire type I system coding gene cluster into the bacterial genome, which will inevitably affect the host. Unintended changes in the genome (DOI: 10.1093 / nar / gkab521)
How to use the plasmid system to more conveniently express type I Cas effector complex and gRNA to inhibit the transcription of target genes in heterologous bacterial hosts has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene expression regulation system and application thereof
  • Gene expression regulation system and application thereof
  • Gene expression regulation system and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Construction of pCsy plasmid

[0040] Taking the pBBR1-MCS5 plasmid as the backbone, the csy gene cluster (SEQ ID NO.1) derived from the UCBPP-PA14 genome of Pseudomonas aeruginosa (NCBI genome sequence number: NC_008463.1) was carried, and the Ptrc promoter (SEQ ID NO. .2) Drive the expression of the csy gene cluster.

[0041] The specific construction method of pCsy plasmid is as follows:

[0042] 1. Amplify the Ptrc promoter fragment using the pACRISPR plasmid (Addgene: Plasmid#113348) as the template

[0043] (1) According to the sequence of pACRISPR plasmid, design the upstream amplification primer Ptrc promoter 5'primer-1: 5'-GATAAGCTTGATATCGAATTCCATATG GTATACACTTTGCCCTTTACA -3' and downstream amplification primers Ptrc promoter 3'primer-1: 5'-CGAAAGCTGTGCTCCTGTTTAAACTCTAGAACTAGT CTTGCTATTTCTAGCTCTAAAAC -3', underlined in the sequence is the primer sequence used for amplification, and the rest are the homology arm sequence required for cloning and l...

Embodiment 2

[0060] Example 2 Construction of pT-Empty plasmid

[0061] Using the pMS402 plasmid as the backbone, the Ptrc promoter and other restriction enzyme recognition sites such as KpnI were first introduced between the XhoI and BamHI sites for subsequent connection of mini-CRISPR.

[0062] The specific construction method of pT-Empty plasmid is as follows:

[0063] 1. Amplify the Ptrc promoter fragment using the pACRISPR plasmid (Addgene: Plasmid#113348) as the template

[0064] (1) According to the sequence of the pACRISPR plasmid, design the upstream amplification primer Ptrc promoter 5'primer-2: 5'-CCCTTTCGTCTTCACCTCGAG GTATACACTTTGCCCTTTACACATTTT -3' and downstream amplification primers Ptrc promoter 3'primer-2: 5'-GCCGCAACTAGAGGATCCGCGGAATTCCGGGTACC CTTGCTATTTCTAGCTCTAAAAC -3', underlined in the sequence is the primer sequence used for amplification, and the rest are the homology arm sequence required for cloning and ligation and the newly introduced restriction enzyme reco...

Embodiment 3

[0076] Example 3 Construction of pT-gene plasmid (taking lacZ gene as an example)

[0077] The structure of pT-gene plasmid is as follows figure 1 shown in "pT-gene".

[0078] The pT-lacZ plasmid was constructed using the lacZ gene (gene ID: 945006) of Escherichia coli MG1655 (NCBI genome sequence number: NC_000913.3) as the target gene.

[0079] (1) gRNA expression sequence - design of mini-CRISPR

[0080] In the promoter region of the lacZ gene (Gene ID: 945006), select the 32bp nucleotide sequence connected downstream of "5'-CC-3'" as the target sequence to design gRNA. The expressed sequence was named mini-CRISPR.

[0081] In this example, the following two different sequences were selected as the target sequence of the gRNA in the promoter region of the lacZ gene (Gene ID: 945006):

[0082] lacZ1: 5'-GCTCACAATTCCACACAACATACGAGCCGGAA-3';

[0083] lacZ2: 5'-TGTGTGAAATTGTTATCCGCTCACAATTCCAC-3'.

[0084] Design mini-CRISPR-lacZ1 based on the sequence of lacZ1: Desig...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene expression regulation system and application thereof. The gene expression regulation and control system comprises a plasmid composition for gene expression regulation and control, the plasmid composition comprises a plasmid 1 and a plasmid 2, and the plasmid 1 is a plasmid with an expression nucleotide sequence as shown in SEQ ID NO.1; the plasmid 2 is a plasmid for expressing mini-CRISPR, and the mini-CRISPR contains a target sequence and a nucleotide sequence as shown in SEQ ID NO.5 at the 5'end and the 3 'end of the target sequence. The I-F type CRISPR-Cas double-plasmid system provided by the invention can accurately identify and combine a promoter region of a target gene, and effective inhibition on transcription expression of the target gene can be realized through conventional plasmid transformation. The system has obvious simplicity and convenience in bacterial gene function research, and meanwhile has wide application prospects in the aspects of bacterial physiology research, metabolic pathway transformation, natural compound synthesis, drug target discovery, novel drug development, high-throughput screening and the like.

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular, to a gene expression regulation system and its application. Background technique [0002] The CRISPR-Cas system is an adaptive immune system that widely exists in prokaryotes against the invasion of exogenous mobile genetic elements such as bacteriophages. The discovery of the CRISPR-Cas system has promoted unprecedented changes in molecular biology. Diagnosis, high-throughput screening, bacterial resistance research and other technical fields have been widely used. At present, CRISPR-Cas systems have also been developed for gene transcriptional repression, using a guide RNA (gRNA) to guide the Cas-effector complex or a Cas-effector protein (such as dCas9) that lacks nuclease activity to a specific target position, by preventing RNA The binding of the polymerase to the promoter of the target gene or preventing the extension of the RNA polymerase on the DNA chain can inhibit th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/22C12N15/55C12N15/113C12N15/70
CPCC12N9/22C12N15/1137C12N15/70C12N2310/20C12Y302/01108Y02A50/30
Inventor徐泽凌陈淑珍刘志晴徐梓锐张炼辉
OwnerSOUTH CHINA AGRI UNIV