Gene expression regulation system and application thereof
A gene expression and effector protein technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve problems such as unexpected changes in the host genome, complex structure of type I systems, etc., and achieve the effect of broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Construction of pCsy plasmid
[0040] Taking the pBBR1-MCS5 plasmid as the backbone, the csy gene cluster (SEQ ID NO.1) derived from the UCBPP-PA14 genome of Pseudomonas aeruginosa (NCBI genome sequence number: NC_008463.1) was carried, and the Ptrc promoter (SEQ ID NO. .2) Drive the expression of the csy gene cluster.
[0041] The specific construction method of pCsy plasmid is as follows:
[0042] 1. Amplify the Ptrc promoter fragment using the pACRISPR plasmid (Addgene: Plasmid#113348) as the template
[0043] (1) According to the sequence of pACRISPR plasmid, design the upstream amplification primer Ptrc promoter 5'primer-1: 5'-GATAAGCTTGATATCGAATTCCATATG GTATACACTTTGCCCTTTACA -3' and downstream amplification primers Ptrc promoter 3'primer-1: 5'-CGAAAGCTGTGCTCCTGTTTAAACTCTAGAACTAGT CTTGCTATTTCTAGCTCTAAAAC -3', underlined in the sequence is the primer sequence used for amplification, and the rest are the homology arm sequence required for cloning and l...
Embodiment 2
[0060] Example 2 Construction of pT-Empty plasmid
[0061] Using the pMS402 plasmid as the backbone, the Ptrc promoter and other restriction enzyme recognition sites such as KpnI were first introduced between the XhoI and BamHI sites for subsequent connection of mini-CRISPR.
[0062] The specific construction method of pT-Empty plasmid is as follows:
[0063] 1. Amplify the Ptrc promoter fragment using the pACRISPR plasmid (Addgene: Plasmid#113348) as the template
[0064] (1) According to the sequence of the pACRISPR plasmid, design the upstream amplification primer Ptrc promoter 5'primer-2: 5'-CCCTTTCGTCTTCACCTCGAG GTATACACTTTGCCCTTTACACATTTT -3' and downstream amplification primers Ptrc promoter 3'primer-2: 5'-GCCGCAACTAGAGGATCCGCGGAATTCCGGGTACC CTTGCTATTTCTAGCTCTAAAAC -3', underlined in the sequence is the primer sequence used for amplification, and the rest are the homology arm sequence required for cloning and ligation and the newly introduced restriction enzyme reco...
Embodiment 3
[0076] Example 3 Construction of pT-gene plasmid (taking lacZ gene as an example)
[0077] The structure of pT-gene plasmid is as follows figure 1 shown in "pT-gene".
[0078] The pT-lacZ plasmid was constructed using the lacZ gene (gene ID: 945006) of Escherichia coli MG1655 (NCBI genome sequence number: NC_000913.3) as the target gene.
[0079] (1) gRNA expression sequence - design of mini-CRISPR
[0080] In the promoter region of the lacZ gene (Gene ID: 945006), select the 32bp nucleotide sequence connected downstream of "5'-CC-3'" as the target sequence to design gRNA. The expressed sequence was named mini-CRISPR.
[0081] In this example, the following two different sequences were selected as the target sequence of the gRNA in the promoter region of the lacZ gene (Gene ID: 945006):
[0082] lacZ1: 5'-GCTCACAATTCCACACAACATACGAGCCGGAA-3';
[0083] lacZ2: 5'-TGTGTGAAATTGTTATCCGCTCACAATTCCAC-3'.
[0084] Design mini-CRISPR-lacZ1 based on the sequence of lacZ1: Desig...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com