Porcine epidemic diarrhea virus variant strain independent of pancreatin as well as construction and application of porcine epidemic diarrhea virus variant strain
A technology for porcine epidemic diarrhea and virus mutation, applied in the direction of virus, application, virus peptide, etc., to achieve the effect of increasing the proliferation titer
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1 Porcine epidemic diarrhea virus recombinant strain rAJ1102-S2' JS2008 build
[0058] (1) Preparation of transcription templates of PEDV AJ1102 strain sgRNA-S2′a and sgRNA-S2′b: two sgRNA primers sgRNA-F1 (identified in SEQ ID NO: 1) targeting the S2′ subunit of PEDV AJ1102 strain S gene were designed ) and sgRNA-F2 (shown in SEQ ID NO: 2), use primer pair sgRNA-F1 and scaffold oligo (shown in SEQ ID NO: 3), primer pair sgRNA-F2 and scaffold oligo to carry out overlap extension PCR respectively, amplify The system is 25 μL Platinum SuperFi GreenPCR Master Mix, 10 μL GC Enhancer, 20 μM each of upstream and downstream primers (final concentration), add ddH 2 O to a total volume of 50 μL. The reaction conditions are as follows: 98°C for 30s; 98°C for 10s, 55°C for 10s, 72°C for 30s; after 30 cycles, extend at 72°C for 10 min. After the reaction, the amplified product was subjected to 1% agarose gel electrophoresis, and the target fragment was recovered with the...
Embodiment 2
[0075] Example 2: PEDV rAJ1102-S2' JS2008 Immunogenicity of the strain
[0076] PEDV rAJ1102-S2′ JS2008 strain, JS2008 strain and AJ1102 strain (the virus content was adjusted to 10 6.5 TCID 50 / mL) were inactivated by 0.2% formaldehyde for 48 hours, and Vero cells were inoculated after the inactivation was completed for inactivation test, and the qualified virus solution was emulsified by adding an equal mass of 201 adjuvant. The emulsified virus liquid was inoculated into 28-day-old PEDV antigen-antibody-negative healthy piglets through the neck muscle, 5 piglets in each group, 2 mL / head, and the same dose was boosted once 14 days after immunization, and 5 piglets were set as control piglets. Blood was collected 14 days, 31 days, and 45 days after the first immunization, and neutralizing antibodies were detected with PEDV AJ1102 and JS2008 strains.
[0077] The result is as Figure 7 and 8 Shown: PEDV rAJ1102-S2′ JS2008 The level of neutralizing antibody against AJ110...
Embodiment 3
[0078] Example 3: Comparison of the results of different segment substitutions or different point mutations of the S2 gene of PEDV AJ1102 strain
[0079] According to the experimental method in Example 1, AJ1102 strain S2 subunit 894 and 976 amino acid single point mutation strains, 894 and 976 amino acid double point mutation strains, AJ1102 strain S2'-HR1 region was replaced by JS2008 strain Recombinant strain and AJ1102 strain HR1 were replaced by JS2008 strain recombinant strain ( Figure 9 shown), the experimental procedure is referring to Example 1, and the primer sequences used for fusion PCR amplification are shown in the table below.
[0080] Primer name Primer sequence (5'→3') Mid-S R894G -F
AGTGGCAGGGTGGTACAAAAAAGGGTCTTTTTATTGAAGACCTGC Mid-S R894G -R
GCAGGTCTTCAATAAAAGA CCC TTTTTGTACCACCCCTGCCACT Mid-S Y976H -F
GCGGCATTGCCTTTTAGCGATGCTGTTCAAGCGAGACTGAATTATC Mid-S Y976H -R
CAGTCTCGCTTGAACAGC ATC GCTAAAAGGCAATGCC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



