Check patentability & draft patents in minutes with Patsnap Eureka AI!

Porcine epidemic diarrhea virus variant strain independent of pancreatin as well as construction and application of porcine epidemic diarrhea virus variant strain

A technology for porcine epidemic diarrhea and virus mutation, applied in the direction of virus, application, virus peptide, etc., to achieve the effect of increasing the proliferation titer

Active Publication Date: 2022-06-10
HUAZHONG AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the recombinant virus has replaced the entire S2 subunit of the PEDV strain YN200, and the recombinant virus has lost part of the antigenic sites in the S2 subunit of the YN200 strain, which is not conducive to the preparation of vaccines against PEDV mutant strains. In addition, there are research reports The dependence of the strain on trypsin can be changed by mutating the amino acid site on the S2 subunit of the S gene of the PEDV strain, but the titer of the virus cannot be improved (Li W et al. A single point mutation creating a furin cleavage site in the spike protein renders porcine epidemic diarrhea coronavirus trypsinindependent for cell entry and fusion. J Virol,2015,89(15):8077-81.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine epidemic diarrhea virus variant strain independent of pancreatin as well as construction and application of porcine epidemic diarrhea virus variant strain
  • Porcine epidemic diarrhea virus variant strain independent of pancreatin as well as construction and application of porcine epidemic diarrhea virus variant strain
  • Porcine epidemic diarrhea virus variant strain independent of pancreatin as well as construction and application of porcine epidemic diarrhea virus variant strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1 Porcine epidemic diarrhea virus recombinant strain rAJ1102-S2' JS2008 build

[0058] (1) Preparation of transcription templates of PEDV AJ1102 strain sgRNA-S2′a and sgRNA-S2′b: two sgRNA primers sgRNA-F1 (identified in SEQ ID NO: 1) targeting the S2′ subunit of PEDV AJ1102 strain S gene were designed ) and sgRNA-F2 (shown in SEQ ID NO: 2), use primer pair sgRNA-F1 and scaffold oligo (shown in SEQ ID NO: 3), primer pair sgRNA-F2 and scaffold oligo to carry out overlap extension PCR respectively, amplify The system is 25 μL Platinum SuperFi GreenPCR Master Mix, 10 μL GC Enhancer, 20 μM each of upstream and downstream primers (final concentration), add ddH 2 O to a total volume of 50 μL. The reaction conditions are as follows: 98°C for 30s; 98°C for 10s, 55°C for 10s, 72°C for 30s; after 30 cycles, extend at 72°C for 10 min. After the reaction, the amplified product was subjected to 1% agarose gel electrophoresis, and the target fragment was recovered with the...

Embodiment 2

[0075] Example 2: PEDV rAJ1102-S2' JS2008 Immunogenicity of the strain

[0076] PEDV rAJ1102-S2′ JS2008 strain, JS2008 strain and AJ1102 strain (the virus content was adjusted to 10 6.5 TCID 50 / mL) were inactivated by 0.2% formaldehyde for 48 hours, and Vero cells were inoculated after the inactivation was completed for inactivation test, and the qualified virus solution was emulsified by adding an equal mass of 201 adjuvant. The emulsified virus liquid was inoculated into 28-day-old PEDV antigen-antibody-negative healthy piglets through the neck muscle, 5 piglets in each group, 2 mL / head, and the same dose was boosted once 14 days after immunization, and 5 piglets were set as control piglets. Blood was collected 14 days, 31 days, and 45 days after the first immunization, and neutralizing antibodies were detected with PEDV AJ1102 and JS2008 strains.

[0077] The result is as Figure 7 and 8 Shown: PEDV rAJ1102-S2′ JS2008 The level of neutralizing antibody against AJ110...

Embodiment 3

[0078] Example 3: Comparison of the results of different segment substitutions or different point mutations of the S2 gene of PEDV AJ1102 strain

[0079] According to the experimental method in Example 1, AJ1102 strain S2 subunit 894 and 976 amino acid single point mutation strains, 894 and 976 amino acid double point mutation strains, AJ1102 strain S2'-HR1 region was replaced by JS2008 strain Recombinant strain and AJ1102 strain HR1 were replaced by JS2008 strain recombinant strain ( Figure 9 shown), the experimental procedure is referring to Example 1, and the primer sequences used for fusion PCR amplification are shown in the table below.

[0080] Primer name Primer sequence (5'→3') Mid-S R894G -F

AGTGGCAGGGTGGTACAAAAAAGGGTCTTTTTATTGAAGACCTGC Mid-S R894G -R

GCAGGTCTTCAATAAAAGA CCC TTTTTGTACCACCCCTGCCACT Mid-S Y976H -F

GCGGCATTGCCTTTTAGCGATGCTGTTCAAGCGAGACTGAATTATC Mid-S Y976H -R

CAGTCTCGCTTGAACAGC ATC GCTAAAAGGCAATGCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a porcine epidemic diarrhea virus variant strain independent of pancreatin as well as construction and application of the porcine epidemic diarrhea virus variant strain. The method specifically comprises the following steps: cutting an infectious clone plasmid pBAC-AJ1102 of a porcine epidemic diarrhea virus variant strain AJ1102 strain by utilizing CRISPR / Cas9, then obtaining a recombinant plasmid pBAC-AJ1102-S2 'JS2008 by replacing the S2'gene of the PEDV AJ1102 strain with the S2' gene of a JS2008 strain in a homologous recombination manner, and carrying out cell transfection to rescue the recombinant virus rAJ1102-S2 'JS2008 independent of pancreatin. The proliferation titer of the recombinant virus rAJ1102-S2 'JS2008 in a cell is obviously higher than that of an AJ1102 strain; compared with the AJ1102 strain, the rAJ1102-S2 'JS2008 strain can induce a higher level of neutralizing antibody aiming at the classic strain JS2008 of the PEDV (Porcine Epidemic Diarrhea Virus).

Description

technical field [0001] The invention belongs to the technical field of animal virology and genetic engineering, and specifically relates to a variant strain of porcine epidemic diarrhea virus independent of trypsin and its construction and application. Background technique [0002] Porcine epidemic diarrhea virus (PEDV) is an enteric coronavirus that mainly causes vomiting, diarrhea, dehydration and death in newborn piglets. In 1971, the emergence of PEDV was first reported in the United Kingdom, and then many European countries also reported the occurrence of PED (Pensaert MB et al. A new coronavirus-like particles associated with diarrhea in swine. Arch Virol, 1978,58:243- 247; Takahashi K et al. An outbreak of swine diarrhea of ​​a new type associated with coronavirus like particles in Japan. Vet Sci, 1983, 45:829-832). And it is found that the vaccine prepared with the classic strain cannot effectively protect the immune pig against the infection of the PEDV variant str...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N15/85C12N15/50A61K39/215A61P31/14
CPCC12N7/00C12N15/85C07K14/005A61K39/12A61P31/14C12N2770/20021C12N2770/20022C12N2770/20034C12N2770/20052C12N2800/107A61K2039/552A61K2039/5252
Inventor 肖少波方六荣李明翔周艳荣方谱县卢佑新彭旋
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More