Construction of pichia pastoris genetically engineered bacterium and application of pichia pastoris genetically engineered bacterium in improvement of methanol assimilation rate and fixation of carbon dioxide

A technology of genetically engineered bacteria and Pichia pastoris, applied in the field of strain metabolism transformation, can solve problems such as low methanol utilization efficiency, and achieve the effects of improving methanol assimilation efficiency, simple operation at the molecular level, and increasing biomass

Pending Publication Date: 2022-06-17
NANJING UNIV OF TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the problem of low utilization efficiency of methanol by Pichia pastoris, the present invention provides a construction of Pichia pastoris genetically engineered bacteria and its application in improving methanol assimilation rate and fixing carbon dioxide, which can not only solve the problem of waste of carbon atoms, but also endow The ability of Pichia pastoris to fix carbon and reuse carbon atoms further improves the utilization efficiency of carbon atoms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of pichia pastoris genetically engineered bacterium and application of pichia pastoris genetically engineered bacterium in improvement of methanol assimilation rate and fixation of carbon dioxide
  • Construction of pichia pastoris genetically engineered bacterium and application of pichia pastoris genetically engineered bacterium in improvement of methanol assimilation rate and fixation of carbon dioxide
  • Construction of pichia pastoris genetically engineered bacterium and application of pichia pastoris genetically engineered bacterium in improvement of methanol assimilation rate and fixation of carbon dioxide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] The FDH gene in the dissimilation pathway was knocked out in Pichia pastoris by CRISPR-Cas9 gene knockout technology, and the recombinant strain GS115-ΔFDH was obtained.

Embodiment 2

[0071] 1. Construction of pGAPZA-MIS1-P2A-GCV1 recombinant plasmid

[0072] Using the Pichia pastoris GS115 genome with MIS1 and GVC1 genes as a template, the nucleotide coding sequences of the corresponding genes were replicated by conventional PCR amplification.

[0073] The MIS1 upstream primers used have homology arms and the sequences are:

[0074] MIS1-F: TATTTCGAAACGAGGAATTGAAACGATGCTTTCAAGAATTGGATCTAGAAAATAAAG

[0075] The MIS1 downstream primer has a P2A sequence as a homology arm, and the sequence is:

[0076] MIS1-R:

[0077] ACGTCTCCTGCTTGCTTTAACAGAGAGAAGTTCGTGGCAAAATAA.

[0078] The GCV1 upstream primer used has the P2A sequence as the homology arm, and the sequence is:

[0079] GCV1-F: TAAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTCCTGAAACGA

[0080] The GCV1 downstream primer has homology arms and the sequence is:

[0081] GCV1-R:

[0082] AGATGAGTTTTTGTTCTAGTCACTCCGGCTTATAAAATTTGGGGGGC.

[0083] The reaction conditions were: 95 °C for 2 min, 95 °C for 20 s, 55 °C ...

Embodiment 3

[0182] Example 3 Phenotypic verification of recombinant strains

[0183] 1. Knockout strain fermentation verification

[0184] To verify the effect of knockout of the DAS gene on the assimilation of Pichia pastoris, the Pichia pastoris GS115 and GS115-ΔDAS strains were inoculated into 5 mL of YPD liquid medium, and shaken at 30 °C and 200 rpm to OD600≈5. The cultured bacterial liquids were all adjusted to the initial OD. 600 = 0.2 centrifugation and resuspension, inoculate in 100 mL of fresh M9 liquid medium and add 1% methanol by volume, shake culture at 30°C and 200 rpm, and take samples every 24 hours to measure the OD. 600 . From the fermentation verification structure, the strain after knocking out the DAS gene cannot grow in the medium with methanol as the only carbon source ( figure 2 (a)).

[0185] 2. Characterization of fermentation of recombinant strains by compartmentalization

[0186] To verify the localization effect of the signal peptide PTS1, the construct...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses construction of a pichia pastoris genetically engineered bacterium and application of the pichia pastoris genetically engineered bacterium in improvement of methanol assimilation rate and fixation of carbon dioxide, a methanol metabolic pathway of pichia pastoris is modified, and carbon atom loss caused by carbon dioxide generated by dissimilation is eliminated by knocking out a dissimilatory pathway and reconstructing a reductive glycine pathway, so that the methanol assimilation rate of the pichia pastoris is improved. And the utilization efficiency of carbon atoms is improved. In order to further improve assimilation of methanol and carbon dioxide, preferentially, a pichia pastoris methanol dissimilatory approach is subjected to comparative rational design, the biomass of a bacterial strain subjected to metabolism modification can be improved by 8.7%, and compared with original pichia pastoris GS115, a genetic engineering bacterial strain has the same methanol consumption rate, but has obvious formic acid accumulation which is about 0.66 g / L; furthermore, it is proved that the pichia pastoris genetically engineered bacterium uses more carbon for central metabolism.

Description

technical field [0001] The invention belongs to the field of strain metabolic transformation, and particularly relates to the construction of a genetically engineered Pichia pastoris and its application in improving methanol assimilation rate and fixing carbon dioxide. Background technique [0002] Global food shortages have prompted the search for alternative sources of raw materials for biofuel or chemical production. Methanol, a non-food-derived C1 feedstock, is emerging as an attractive alternative for industrial biomanufacturing due to its low price and high energy content. Methanol can be easily produced from coal, natural gas or other renewable resources, with a global annual production capacity of over 100 million tons. In recent years, through CO 2 A breakthrough has been made in the technology of hydrogenation to synthesize methanol. The development of methanol biomanufacturing is a key factor in building a sustainable circular carbon economy. [0003] Methylot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N1/19C12N15/31C12N15/52C12N15/53C12R1/84
CPCC12N15/815C12N1/16C07K14/39C12Y603/02017C12Y102/01002C12Y102/01046C12N9/0008C12N9/93
Inventor王昕郭元柯王静马琛陈可泉
OwnerNANJING UNIV OF TECH