Recombinant protein as well as expression method, purification method and application thereof
A technology of recombinant protein and expression method, which is applied in peptide preparation methods, chemical instruments and methods, recombinant DNA technology, etc., can solve the problems of easy loss of activity and low yield of F protein, achieve high-level expression, and facilitate protein purification Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0087] Embodiment 1, the expression method of RSV-F recombinant protein
[0088] 1. Amplification of RSV-F coding fragment
[0089] The amplification of the RSV-F coding fragment takes the optimized RSV-F nucleotide sequence as the template, and PCR amplifies the RSV-F fragment;
[0090] specifically,
[0091] The RSV-F nucleotide sequence is nt94-nt1563 of SEQ ID No.1 of the sequence listing;
[0092] specifically,
[0093] Take the optimized sequence of the natural fusion protein gene coding sequence of the Long strain of wild-type RSV as a template, and design the following primers according to the optimized sequence:
[0094] F-f GAA ACCGGT CAGAATATCACCGAGGAGTTC(Age I)
[0095] F-r CTT GGTACC TCATTACAGCAGCTCATCGGACTTCC(KpnI)
[0096] Amplify the gene sequence of the extracellular region (AA26-AA512) without the signal peptide of the RSV-F protein, that is, the gene open reading frame nt94-nt1557;
[0097] specifically,
[0098] PCR reaction conditions: pre-denat...
Embodiment 2
[0134] Embodiment 2, the purification method of RSV-F recombinant protein
[0135] The RSV-F recombinant protein expressed in Example 1 was purified, and the purification steps were:
[0136] 1. Anion exchange purification: use Capto Q anion exchange column for purification, first use 15 times the column volume of binding buffer A (0.04M NaH 2 PO 4 , 0.06M Na 2 HPO 4 , pH 7.0) to equilibrate the column; then dilute the concentrated solution of the culture supernatant containing the target protein with buffer A, and adjust the pH of the sample to be the same as the pH of the buffer; load the sample with the sample pump, and set the sample volume (500ml) , flow rate (3ml / min), pre-column pressure (0.3MPa), column pressure difference (0.2MPa) and other parameters, make the sample flow through the column under the set conditions, and collect the flow-through liquid for SDS-PAGE analysis. Chromatograms such as Figure 5 As shown, the electropherogram is shown in Figure 8 sho...
Embodiment 3
[0139] Embodiment 3, analyze the purity of RSV-F recombinant protein
[0140] 1. Determination of protein content by BCA method
[0141] Standard protein BSA (2 mg / ml) was diluted in PBS to prepare standard series of 0, 25, 125, 250, 500, 750 and 1000 [mu]g / ml. Take 4ul of each series of standards and purified samples of appropriately diluted recombinant proteins and add them to the standard wells of a 96-well plate, add 200ml of BCA working solution to each well, place at room temperature for 5min, and measure the absorbance at 595nm with a microplate reader. Draw a standard curve (y=1.2787x-0.516) with the standard concentration and absorbance, where y is the protein concentration, x is the absorbance, and the sample concentration is calculated.
[0142] 2. Analysis of protein purity with a grayscale scanner
[0143] The expressed target protein was purified, and the target protein harvested after three-step purification was subjected to SDS-PAGE, and the purity of the exp...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com