Coxsackie virus A10 type strain and vaccine and application thereof

A coxsackie virus, A10 technology, applied in the direction of antiviral immunoglobulin, application, antiviral agent, etc., can solve the problem of low separation rate, achieve good immunogenicity, good passive immunity, strong cross-neutralization ability Effect

Active Publication Date: 2022-07-22
BEIJING MINHAI BIOTECH
View PDF11 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Katsumi Mizuta et al. used the CV-A10 strain to infect different cell lines and found that it could not grow in Vero cells (Mizuta, Katsumi et al. "Longitudinal epidemiology of viral infectious diseases combining virus isolation, antigenic analysis and phylogenetic analysis as well as seroepidemiology in Yamagata, J between1999 and 2018." Japanese journal of infectious diseases (2019): n. pag.); Bian Lianlian et al. also showed that the segregation rate of CV-A10 was low (Bian Lianlian, Liu Siyuan, Jiang Wei, Mao Qunying, Gao Fan, Yang Xiaoming, Liang Zhengyu .Multivalent HFMD Vaccine: Reality and Dream[J].Chinese Journal of Biological Products,2020,33(01):106-112.DOI:10.13200 / j.cnki.cjb.002971)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Coxsackie virus A10 type strain and vaccine and application thereof
  • Coxsackie virus A10 type strain and vaccine and application thereof
  • Coxsackie virus A10 type strain and vaccine and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0091] Example 1 Isolation and culture of CV-A10 virus strain

[0092] 1. Processing of clinical samples

[0093] The clinical samples were processed according to the guidelines for the prevention and control of hand, foot and mouth disease (2009 edition).

[0094] 2. Virus isolation

[0095] The processed samples were inoculated into healthy, non-polluting African green monkey kidney passage cells (Vero) at a density of 80-90% in a certain proportion at 35°C, 5% CO. 2 Adsorbed in the incubator for more than half an hour, replenished to the culture volume, 35°C, 5% CO 2 The cells were cultured in an incubator, and a cell control without sample was set at the same time. Use an inverted microscope to observe the cells every day, such as enterovirus cytopathic effect (CPE): cells become round, the refraction is enhanced and detached from the tube wall, etc., the changes are recorded, and the changes in the cells in the inoculated wells and the control wells are continuously ob...

Embodiment 2

[0098] Example 2 Identification and detection of virus

[0099] The fourth-generation virus liquid of Coxsackie virus A10 strain V05790834 harvested in Example 1 was subjected to molecular identification, genome sequencing, titer detection and immunogenicity detection.

[0100] 1. Molecular identification and genome sequencing

[0101] The virus was identified by RT-PCR, and the general primers and VP1-specific primers used for enterovirus nucleic acid detection are shown in Table 1.

[0102] Table 1 Universal primers and VP1-specific primers for enterovirus nucleic acid detection

[0103]

[0104] (1) Virus nucleic acid extraction

[0105] Take the fourth-generation virus solution, add reagents and virus samples according to the instructions, then place it in a nucleic acid extractor, extract nucleic acids according to preset procedures, and store the extracted nucleic acids in a -70°C refrigerator.

[0106] (2) PCR detection of HEV-5UTR universal primers

[0107] Nest...

Embodiment 3

[0137] Example 3 Stability detection of CV-A10 strain

[0138] 1. Genetic stability

[0139] After plaque purification of Coxsackievirus A10 strain V05790834 was performed three times, serial passage was performed at the same MOI. The specific method is as follows: inoculate healthy and pollution-free Vero cells of passage ≤147 in a cell culture flask, and then grow to a density of about 90%. +++, harvest the virus solution and store it at -60°C or below. For each generation of harvest, the generation increases by one generation. The harvested virus solution was continuously passaged to P15 using the same method, and the virus harvest solution of each generation was replaced for P1 sequence amplification and sequencing.

[0140] P1 sequence amplification primers are shown below, and the target fragment size is about 3Kb:

[0141] CVA10-P1-F1 (5'-3'): TACCATATAGCCTATTGGATTGGCCATCCGG;

[0142] CVA10-P1-R (5'-3'): CTCGTGAGCTACTTTCCCATACTAAATTTG.

[0143] The amplification r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, in particular to a coxsackie virus A10 type strain and a vaccine and application thereof. The amino acid sequences of VP4, VP3, VP2 and VP1 proteins of the coxsackie virus A10 type strain are respectively shown as SEQ ID NO.1, 2, 3 and 4, and the amino acid sequences of 2A, 2B, 2C, 3A, 3B, 3C and 3D proteins are respectively shown as SEQ ID NO.5, 6, 7, 8, 9, 10 and 11. The virus strain is obtained by adopting Vero cell separation, is susceptible to Vero cells, can obtain higher titer, has the advantages of good immunogenicity, strong cross neutralization capability, genetic stability and the like, and can be used for preparing vaccines or medicines for preventing or treating coxsackie virus A10 infection or diseases caused by the coxsackie virus A10 infection.

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular to Coxsackie virus A10 strains and vaccines and applications thereof. Background technique [0002] Hand-foot-mouth disease (HFMD) is a common infectious disease of infants and young children caused by a variety of enteroviruses, typically manifested as rashes, herpes, ulcers, etc. on the hands, feet, and mouth, which can be complicated by Aseptic meningitis, encephalitis, acute flaccid paralysis, respiratory infection and myocarditis, etc., individual severe cases can lead to disability or death. [0003] The main pathogenic serotypes of hand, foot and mouth disease include Coxsackievirus (Coxsackievirus, CV) A group 4-7, 9, 10, 16 and B group 1-3, 5, part of the serotype of Echovirus (Echovirus) type and enterovirus 71 (Enterovirus A71, EV-A71). At present, CV-A16, EV-A71, CV-A6, and CV-A10 are one of the main pathogens that cause hand, foot and mouth disease, and there is n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N7/00C12N15/41C07K14/085C07K16/10C07K16/06A61K39/125A61P31/14G01N33/569C12R1/93
CPCC12N7/00C07K14/005C07K16/1009C07K16/065A61K39/12A61P31/14G01N33/56983C12N2770/32621C12N2770/32622C12N2770/32623C12N2770/32634G01N2333/085G01N2469/10A61K2039/521
Inventor肖霞张德宝顾美荣李国顺陈磊郭林简伟肖海峰徐颖之张改梅刘建凯
OwnerBEIJING MINHAI BIOTECH