Tobacco strong nuclear matrix binding sequence, separating identification method and use thereof

A nuclear matrix combination and sequence technology, applied in the field of tobacco strong MAR sequence and its isolation and identification, to achieve high expression activity, enhanced high-efficiency expression, and improved yield

Inactive Publication Date: 2003-03-12
SHANDONG AGRICULTURAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are few such studies in China, and the MAR sequence that can significantly regulate the expression of exogenous genes and is suitable for constructing high-efficiency expression vectors in plants has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tobacco strong nuclear matrix binding sequence, separating identification method and use thereof
  • Tobacco strong nuclear matrix binding sequence, separating identification method and use thereof
  • Tobacco strong nuclear matrix binding sequence, separating identification method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Cloning of a tobacco strong MAR sequence

[0043] a. PCR Reagents and Conditions for Polymerase Chain Reaction (PCR)

[0044] The template DNA of the PCR reaction is tobacco genome DNA. Tobacco (Nicotiana tabacum L.cv NC89) was grown in the greenhouse, and its leaves were used for the extraction of genomic DNA, which was extracted by the CTAB method

[0045] First mix the following reagents together:

[0046] 10×Taq DNA polymerase buffer 5 μl

[0047] Template DNA (100 ng / μl) 1 μl

[0048] Forward primer (100 nmol / L) 1 microliter

[0049] Reverse primer (100 nmol / L) 1 microliter

[0050] Deoxynucleotide mixture (dNTPs, 100 nmol / L) 1 μl

[0051] Taq DNA polymerase (5 units / μl) 0.5 μl

[0052] Sterilized redistilled water 30.5 microliters

[0053] Total volume 50 µl

[0054] The conditions of the PCR reaction were as follows: denaturation at 94°C for 5 minutes, followed by the following cycles: 94°C for 40 seconds, 46°C for 50 seconds, 72°C for 90 seco...

Embodiment 2

[0066] Example 2: In vitro binding experiment of MAR sequence and nuclear matrix

[0067] a. Suspension culture Rice seeds were used to induce callus on Ms modified medium (yeast powder 0.3%, 2,4-D 2 mg / L, 6 BA 0.5 mg / L). The loose and friable callus was picked and subcultured in AA (2,4-D 1 mg / L) liquid medium at 26° C., 110 rpm, every 9 days.

[0068] b. Extraction of cell nuclei Get 10 ml of suspension cells (cell volume) cultured to the 7th day, treat in 20 ml of enzymolysis solution containing 2% cellulase RS, 1% isolated enzyme and 0.2% pectinase Y 23, use Homogenize with a full glass homogenizer until it is ground to a single cell, pass through the 22μm and 15μm stainless steel mesh to sieve the coarse suspension of nuclei, centrifuge at 5000g for 20min, collect the precipitate, and use 60% and 30% Percoll 1000g discontinuous density Gradient centrifugation to collect the precipitate. 15OD(A per ml 260 ) was suspended in 24ml preservation solution, frozen in liquid n...

Embodiment 3

[0071] Embodiment 3: Construction of plant expression vector

[0072] The MAR sequence was inserted into pBI121 ( figure 2(a)) Both sides of the gus gene expression cassette. MAR was excised from the plasmid pGEMpMAR with EcoR I, and a part was inserted into the EcoR I restriction site on the pBI121 treated with alkaline phosphatase to obtain the plasmid pBI121MAR I ( figure 2 (b)). The direction of insertion of the fragment was identified by PCR amplification using the gus upstream primer (ATGTTACGTCCTGTAGAAACCCCA) and the 3' end-specific primer of MAR. The expression vector pBI121MAR I inserted into the MAR was screened out, digested with Hind III and then dephosphorylated with alkaline phosphatase, and then the other part of the MAR with the sticky end of EcoR I was filled with Klenow enzyme and connected with the Hind III linker. Inserted into the HindIII restriction site of pBI121MAR I after Hind III digestion to generate pBI121MARII ( figure 2 (c)), using the 35S ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A strong nuclear matrix binding sequence (MAR) of tobacco and its separating and assay method and application are disclosed. A novel strong MAR sequence is separated from the tobacco genom and has the typical characteristics of MAR sequence and the stronger speicfic binding power with nuclear matrix in vitro. Said MAR sequence can be used to construct plant gene expression vector, that is, antrorsly constructing it at both sides of the gene expression cassette of expression vector pBI121 gus. It can increase the average expression level of exogenous gus gene by 5 times, and used in genetic engineering.

Description

(1) Technical field [0001] The invention relates to a strong nuclear matrix binding sequence (MAR) of tobacco and its separation and identification method and application, belonging to the fields of cell biology and eukaryotic gene expression regulation. It specifically relates to a tobacco strong MAR sequence and its isolation and identification method and application. The MAR sequence can be applied to the construction of plant expression vectors to improve the stable and high-efficiency expression level of foreign genes in transgenic plants. (2) Background technology [0002] Transgenic technology is widely used in species improvement and basic research of molecular biology. With the acquisition of a large number of transgenic plants, it is found that the problems of exogenous gene silencing and exogenous gene expression are common. In recent years, studies have shown that constructing MAR sequences on both sides of the exogenous gene expression box of the expression vect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor郑成超张可伟王健美杨国栋
OwnerSHANDONG AGRICULTURAL UNIVERSITY