Production of bioarailable folic acid
A technology of microorganisms and monoglutamyl folate, which is applied in the field of various raw and microbial foods, can solve problems such as which specific gene is not used or which result is expected.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 2
[0024] Example 2 illustrates the overexpression of GTP-cyclohydrolase (EC 3.5.4.16) and 2-amino-4-hydroxy-6-hydroxymethyldihydropterin pyrophosphatase (EC 2.7.6) in Lactococcus lactis .3) the role of. In Lactococcus lactis, the gene gch encodes a bifunctional protein with these two enzymes. This effect not only increased total folic acid production, but also specifically increased monoglutamyl folate production and decreased polyglutamyl folate production in the medium using recombinant Lactococcus lactis. This can be explained by the relatively low activity of folyl polyglutamate synthase, encoded by the gene folC, which is not sufficiently active to accommodate the higher levels of folate produced by overexpression of GTP-cyclohydrolase. Biosynthesis. Monoglutamyl folic acid is more easily secreted by Lactococcus lactis, so that the fermentation medium not only has an increased level of folic acid, but also has a more bioavailable form that is secreted into the medium in t...
Embodiment 1
[0028] Materials and methods
[0029] The mature endopeptidase human γ-glutamyl hydrolase was obtained from the full-length cDNA cloned in the vector pCR2 (Yao et al., 1996a) by polymerase chain reaction. Vectors were provided by the Molecular Diagnostics Laboratory, Wadsworth Center, Albany, New York. The following primers were used to obtain an 885 bp PCR product encoding mature human γ-glutamyl hydrolase:
[0030] HGH-f(CATGCCATGGGACCCCACGGCGACACCGCCAAG) and
[0031] HGH-r (GCTCTAGATCAATCAAATATGTAACATTGCTG).
[0032] The forward primer was extended at the 5' end to create an NcoI restriction site enabling a transcriptional fusion to the nisin-inducible promoter of vector pNZ8048 (Kuipers et al.). Use of the forward primer as described results in slight modification of the mature gene (nucleotides in italics). The reverse primer was extended at the 3' end to create an XbaI restriction site that allowed cohesive end ligation to vector pNZ8048. A newly synthesized vector ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
