Vaccine for human papiloma virus

A technology of dengue virus and pseudovirion particles, applied in the field of dengue virus, can solve the problems of low success rate of dendritic cell expansion and activation, time-consuming and laborious, difficult to achieve quality control, etc.

Inactive Publication Date: 2004-09-01
上海天甲生物医药有限公司 +2
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method is time-consuming, labor-intensive, and costly. The success rate of dendritic cell culture, expansion and activation is low, and it is difficult to achieve quality control.
Therefore, this method of completely individualizing and customizing tumor vaccines cannot be industrialized and is difficult to promote and apply.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vaccine for human papiloma virus
  • Vaccine for human papiloma virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0099] Preparation process of full-length dengue virus cDNA clone

[0100] 1. Integrate the full-length dengue virus cDNA into the pRS424 plasmid (Plasmid) to prepare a full-length dengue virus cDNA clone. The dengue virus type II NGC (ATCC #: VR-1255) and pRS424 plasmid (ATCC #: 77105) were purchased from the American Type Culture Collection (ATCC).

[0101] a) Dengue virus RNA is converted into three segments of dengue virus cDNA fragments (5' end cDNA, 3' end cDNA and middle segment cDNA) by RT-PCR method, and Xba I is added to the 5' end of the 5' end cDNA fragment Restriction site and Sp6 enhancer sequence; Sac I enzyme site is added to the 3' end of the 3' end fragment; the two ends of the middle fragment include part of the 3' end and 3' end cDNA fragment of the 5' end cDNA fragment The same gene sequence at the 5' end.

[0102] Primer

Sequence (5'-3')

SEQ ID NO:

1a.

TGCACATTCGCTCTAGAATTTAGGTGACACTATAGAGTTGTTAGTCTACGTGGACC

6

...

Embodiment 2

[0111] Preparation of HPV E7-E6-2A DNA Fragment

[0112] (i) wherein the E7-E6 sequence is an HPV oncogene (Gene Bank accession numbers: AF486352; AF469197; AF472508), as shown in SEQ ID NO: 1, encoding a 256 amino acid antigen (SEQ ID NO: 2).

[0113] (ii) The 2A is a gene fragment of foot-and-mouth disease virus, consisting of 60 bases, and its gene sequence is shown in SEQ ID NO: 3 in the sequence table.

[0114](iii) Using the HPV-16 plasmid (ATCC#: 45113D) as a template, using GCGAGAAATACGCCTTTCAATATGCTGAAACGCGAGAGAAACATGCATGGAGATACACCTACA (SEQ ID NO: 12) and TGCAGTTCTCTTTTGGTGCATTGGTTTCTGAGAACAGATGGG (SEQ ID NO: 13) as a pair of primers respectively; and using ATGCACCAAAAGAGAACTG AAGGTCAAAAATTCAACAGCTGGGTTTCTCTACGTGT (SEQ ID NO: 15) was used as another pair of primers to prepare E6 and E7 cDNA fragments by PCR. The 21nt of the 5' end of the E6 cDNA fragment is identical to the partial sequence of the 3' end of the E7 cDNA fragment, the 21nt of the 3' end of the E6 cDNA ...

Embodiment 3

[0117] The Process of Integrating HPV Viral Genes into Dengue Virus RNA Replicon

[0118] 1. The full-length dengue virus cDNA clone (abbreviated as pRS / FLD2) prepared in the first step c) of Example 1. Cut into lines with BamH I endonuclease.

[0119] 2. Transform the linear dengue fever virus cDNA clone (pRS / FLD2) and the HPV E7-E6-2A cDNA fragment together into yeast (yeast). During the DNA replication process of the yeast, the HPV E7-E6-2A cDNA fragment can Automatically integrated into the dengue virus cDNA clone, and replace the gene sequence of the dengue virus structural protein (including the C coding region sequence, the M coding region sequence and the E coding region sequence), to generate a large number of circular HPV-dengue fever virus RNA replicons cDNA clone (ie pRS / D2-HPV16).

[0120] 3. The cDNA clone of the HPV-dengue virus RNA replicon produced in step 2 was purified from yeast with Qiagencolumn (QIAGEN Inc.).

[0121] 4. Transformation of Stabl2 with c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a false virus granule vaccine with dengue fever virus recombination replicon as a core and method for preparation, wherein the vaccine can express antigens with high efficiency in the affected cells, because of the characteristic of affecting dendritic cell of the dengue fever virus, the antigen can be extracted effectively with good immunity effect. The vaccine can be used for preventing and treating tumor and virosis.

Description

technical field [0001] The present invention relates to dengue fever virus, specifically the recombinant vaccine that replaces the structural protein gene of dengue fever virus with HPV specific antigen, and its preparation method and application. Background technique [0002] Cancer is a disease that seriously threatens human life. Many cancers are associated with viruses. Taking cervical cancer as an example, it has been recognized that human papilloma virus (HPV) infection can lead to sexually transmitted diseases and cancers of the reproductive tract. The rate and degree of HPV infection gradually increase with the aggravation of cervical lesions, which can be briefly described as: chronic cervicitis → pseudocondyloma → verrucous lesions → condyloma acuminatumcervical intraepithelial neoplasiacervical cancer. HPV has a wide range of infected populations, the infection rate of women in my country is 10-40%, and the infection rate of European women is as high as 40...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K35/76A61K35/768A61K39/12A61P35/00C12N5/10C12N7/01C12N15/55C12N15/86
CPCY02A50/30
Inventor庞小伍
Owner上海天甲生物医药有限公司