Process of preparing D-amino acid oxydase

An oxidase and amino acid technology, applied in the field of bioengineering, can solve problems such as difficult separation and achieve high-efficiency expression

Inactive Publication Date: 2005-01-05
FUDAN UNIV
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it was found that in the process of separation and purification of DAAO, it is always accompanied by the activity of catalase, and it is difficult to achieve complete separation of the two with commonly used separation and purification techniques.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process of preparing D-amino acid oxydase
  • Process of preparing D-amino acid oxydase
  • Process of preparing D-amino acid oxydase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1 Obtaining mutant D-amino acid oxidase gene

[0018] According to the known DAAO gene sequence of Trigonopsis Vriablis and the codons corresponding to histidine, the mutation primers were designed as follows:

[0019] 5'primer 5' GGATCC ATGCACCATCATCATCATCAT ATGGCTAAAA TCGTTGTT

[0020] 3'primer 5' GCGGCCGC The TTAATGATGATGATGATGATG AAGGTTT GGACGAGTAAG template gene is derived from the plasmid pPIC3.5K-DAAO described in the patent CN 1385521A, and the DAAO gene is amplified by high-fidelity PCR (Pfu enzyme, purchased from the company), and the 5' and 3' ends of the coding sequence are respectively A Histag sequence that continuously encodes 6 histidines was introduced, and enzyme cleavage sites corresponding to NotI and BamHI were respectively introduced. The PCR reaction conditions are: 94°C for 5min, 1 cycle; 94°C for 30s, 40°C for 30s, 72°C for 75s, 5 cycles; 94°C for 30s, 58°C for 30s, 72°C for 75s, 30 cycles; finally, 72°C for 10min , 1 cycle.

[...

Embodiment 2

[0022] Example 2 Blunt-end cloning of mutant DAAO gene into plasmid pBluescript(SK+)

[0023] Plasmid pBluescript (SK+) was linearized with SmaI and used as a vector for blunt-end cloning. The mutant DAAO gene fragments recovered from the gel were ligated in vitro with the vector, and the reaction system (20 μl) was as follows:

[0024] pBluescript (SK+) 2μl

[0025] PCR product 10μl

[0026] 10x ligation buffer 2 μl

[0027] T4 DNA Ligase (1U / μl) 1μl

[0028] Water 5μl

[0029] The mixture was reacted overnight at 16°C. The obtained ligation product was transformed into E.coli TG1 competent cells, spread on LB plates containing ampicillin resistance, and the white transformants were selected to extract plasmid DNA, and the obtained DNA was proved to be pSK-DAAO by PCR and enzyme digestion.

Embodiment 3

[0030] Example 3 Construction of expression plasmid pPIC3.5K-hisDAAO

[0031] Digest pSK-DAAO with NotI and BamHI, perform electrophoresis on 1% agarose gel, recover a fragment of about 1.3Kb from the gel, and then ligate it with the pPIC3.5K plasmid that has undergone the same double digestion in vitro. The reaction system is as follows:

[0032] pPIC3.5k (NotI and BamHI cut) 2μl

[0033] DAAO gene fragment 15μl

[0034] 10x ligation buffer 2μl

[0035] T4 DNA ligase

[0036] The above mixture was reacted overnight at 16°C. The resulting ligation product was transformed into E.coli TG1 competent cells, spread on LB plates containing ampicillin resistance, and the transformants were selected to extract plasmid DNA. The obtained DNA was proved to be pPIC3.5K-DAAO by PCR and enzyme digestion.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention is a method of preparing D-amino acid oxidase, relating to a method of preparing flavo-enzyme D-amino acid oxidase. Concretely, it relates to a method of highly efficiently producing mutational D-amino acid oxidase by constructing recombinant engineering strains. It reconstructs wild D-amino acid oxidase coming from Trigonopsis variablilis by means of gene engineering, fuses a segment of Histag at N end and C end of the wild enzyme, and further implements high-efficiency fast separation of mutational enzyme by affinity chromatography. The expression level of the enzyme in fermentation liquor is 4000IU / mL, higher than that of the wild enzyme, and the recovery ratio of Ni-column affinity chromatography is 50%. The purified enzyme can be used in making high-efficient oxidation conversion of cephalosporin C- to produce glutaryl-7-ACA and be used together with GL-7-ACA to produce 7-ACA.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to a method for preparing flavoprotease D-amino acid oxidase. It specifically relates to a method for efficiently producing mutant D-amino acid oxidase by constructing recombinant engineering strains. Background technique [0002] D-Amino Acid Oxidase (D-Amino Acid Oxidase.EC 1.4.3.3.DAAO) is a typical flavoenzyme with flavin adenine dinucleotide (FAD) as a prosthetic group, which widely exists in animals and various in microorganisms. The natural enzyme protein is a dimer of 86kDa, which has the activity of catalyzing the oxidation of cephalosporin C. Mammalian DAAO binds loosely to the prosthetic group FAD, and the prosthetic group is easily lost to inactivate the enzyme; while some yeasts bind strongly to the prosthetic group FAD and have higher activity. In practical application, DAAO of Trigonopsis tricornutum is the most commonly used and has the greatest application p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/19C12N9/02C12N15/63C12P1/02C12P21/02
Inventor周佩冯美卿史训龙袁中一
OwnerFUDAN UNIV