Gene detection method and gene detection apparatus
A gene detection and genetic technology, applied in the direction of biochemical equipment and methods, biological testing, material inspection products, etc., can solve the problem of detection sensitivity reduction and achieve high sensitivity effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach 1
[0069] Next, the gene detection method in Embodiment 1 will be described.
[0070] First, a gene sample to be tested is prepared. For this genetic sample, as described above, double-stranded nucleic acid is freed by destroying cells in any sample, and denatured into single-stranded by heat treatment or alkali treatment.
[0071] At this time, the destruction of the cells in the aforementioned sample can be carried out according to a conventional method. For example, it can be performed by externally applying physical effects such as vibration and ultrasonic waves. In addition, a nucleic acid extraction solution (for example, a solution containing a surfactant such as SDS, Triton-X, Tween-20, or saponin, EDTA, protease, etc.) can also be used to free nucleic acid from cells.
[0072] Next, a single-stranded nucleic acid probe having a base sequence complementary to the gene sequence to be detected is generated.
[0073] As such nucleic acid probes, nucleic acids extracted fr...
Embodiment approach 2
[0126] In the above-mentioned Embodiment 1, it was described that a plurality of treatment tanks for performing a plurality of treatments on the electrode 2 are provided, and each treatment is performed in different treatment tanks, but in this Embodiment 2, the treatment tanks are combined into one, and in this The case where the electrode 2 is processed in one processing tank.
[0127] FIG. 2 is a diagram showing the configuration of a gene detection device according to the second embodiment. In Fig. 2, the gene detection device 200 has a processing tank 23 for processing the electrodes 2. 25 is an electrode moving part that moves the electrodes in the horizontal direction inside the processing tank 23. For example, a platform (stage) can be used for example. Mechanical devices that move in parallel, etc. Further, 27 is a waste liquid tank for discharging the liquid stagnated in the treatment tank 23 .
[0128] In the above-mentioned processing tank 23, the electrode 2 fix...
Embodiment 1
[0142] Below, examples of the present invention are disclosed, but the present invention is not limited by these examples.
[0143] (1) Immobilization of nucleic acid probes on the surface of gold electrodes
[0144] 10 nm of titanium was formed on a glass substrate by a sputtering device (SH-350 manufactured by Albac), 200 nm of gold was formed on a substrate, and an electrode pattern was formed by a photolithography process to prepare a gold electrode. The surface of the electrode was washed with pirania solution (hydrogen peroxide: concentrated sulfuric acid = 1:3) for 1 minute, washed with pure water, and dried by blowing nitrogen.
[0145] As the nucleic acid probe, a sequence of CCCCCTGGAT CCAGATATGC AATAATTTTCCCACTATCAT located at positions 629-668 at the 5'-end of the gene sequence derived from human-derived Cytochrome P-450 was used, and 40 bases of mercapto groups were modified with phosphate groups at the 5'-end base oligodeoxynucleotide (manufactured by Takara Bio...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
