Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene detection method and gene detection apparatus

A gene detection and genetic technology, applied in the direction of biochemical equipment and methods, biological testing, material inspection products, etc., can solve the problem of detection sensitivity reduction and achieve high sensitivity effect

Inactive Publication Date: 2007-04-11
PANASONIC CORP +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the intercalating agent that can be used in conventional gene detection is non-specifically adsorbed to the surface of the single-stranded nucleic acid probe and the electrode on which the nucleic acid probe is immobilized.
Then, this non-specifically adsorbed intercalating agent forms background noise when detecting the amount of the intercalating agent bound to the double-stranded nucleic acid, and becomes a cause of lowered detection sensitivity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene detection method and gene detection apparatus
  • Gene detection method and gene detection apparatus
  • Gene detection method and gene detection apparatus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach 1

[0069] Next, the gene detection method in Embodiment 1 will be described.

[0070] First, a gene sample to be tested is prepared. For this genetic sample, as described above, double-stranded nucleic acid is freed by destroying cells in any sample, and denatured into single-stranded by heat treatment or alkali treatment.

[0071] At this time, the destruction of the cells in the aforementioned sample can be carried out according to a conventional method. For example, it can be performed by externally applying physical effects such as vibration and ultrasonic waves. In addition, a nucleic acid extraction solution (for example, a solution containing a surfactant such as SDS, Triton-X, Tween-20, or saponin, EDTA, protease, etc.) can also be used to free nucleic acid from cells.

[0072] Next, a single-stranded nucleic acid probe having a base sequence complementary to the gene sequence to be detected is generated.

[0073] As such nucleic acid probes, nucleic acids extracted fr...

Embodiment approach 2

[0126] In the above-mentioned Embodiment 1, it was described that a plurality of treatment tanks for performing a plurality of treatments on the electrode 2 are provided, and each treatment is performed in different treatment tanks, but in this Embodiment 2, the treatment tanks are combined into one, and in this The case where the electrode 2 is processed in one processing tank.

[0127] FIG. 2 is a diagram showing the configuration of a gene detection device according to the second embodiment. In Fig. 2, the gene detection device 200 has a processing tank 23 for processing the electrodes 2. 25 is an electrode moving part that moves the electrodes in the horizontal direction inside the processing tank 23. For example, a platform (stage) can be used for example. Mechanical devices that move in parallel, etc. Further, 27 is a waste liquid tank for discharging the liquid stagnated in the treatment tank 23 .

[0128] In the above-mentioned processing tank 23, the electrode 2 fix...

Embodiment 1

[0142] Below, examples of the present invention are disclosed, but the present invention is not limited by these examples.

[0143] (1) Immobilization of nucleic acid probes on the surface of gold electrodes

[0144] 10 nm of titanium was formed on a glass substrate by a sputtering device (SH-350 manufactured by Albac), 200 nm of gold was formed on a substrate, and an electrode pattern was formed by a photolithography process to prepare a gold electrode. The surface of the electrode was washed with pirania solution (hydrogen peroxide: concentrated sulfuric acid = 1:3) for 1 minute, washed with pure water, and dried by blowing nitrogen.

[0145] As the nucleic acid probe, a sequence of CCCCCTGGAT CCAGATATGC AATAATTTTCCCACTATCAT located at positions 629-668 at the 5'-end of the gene sequence derived from human-derived Cytochrome P-450 was used, and 40 bases of mercapto groups were modified with phosphate groups at the 5'-end base oligodeoxynucleotide (manufactured by Takara Bio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

It is intended to provide a gene detection method whereby a gene having a specific sequence in a specimen can be detected at a high sensitivity and an apparatus therefor. Namely, a method comprising: the gene sample preparation step wherein a gene having a specific sequence to be detected in a specimen is denatured into a single-stranded gene to give a gene sample; the immobilization step wherein a single-stranded nucleic acid probe having a base sequence complementary to the gene sample sequence is immobilized on an electrode; the double-stranded nucleic acid formation step wherein the gene sample is added to the electrode having the nucleic acid probe immobilized thereon to thereby form a double-stranded nucleic acid via the hybridization of the nucleic acid probe with the gene sample on the electrode; the intercalator addition step wherein an intercalator being electrochemically active and undergoing a covalent bond together with the double-stranded nucleic acid upon photo irradiation is added; the photo irradiation step wherein the double-stranded nucleic acid is covalently bonded to the intercalator by photo irradiation; the washing step wherein the double-stranded nucleic acid and the unreacted intercalator are washed; and the measurement step wherein the intercalator having been covalently bonded to the double-stranded nucleic acid is detected by electrochemical measurement.

Description

technical field [0001] The present invention relates to a gene detection method and its device for detecting a target gene with a specific gene sequence existing in a sample by reading the electrochemical luminescence of an intercalator. Background technique [0002] In the past, the method for detecting specific gene sequences by electrochemical methods was: a single-stranded nucleic acid probe with a base sequence complementary to the target gene to be detected was fixed on the surface of the electrode, and the target gene sample denatured into a single strand was mixed with the target gene. After the nucleic acid probe is hybridized, an electrochemically active intercalating agent specifically binding to the nucleic acid probe and the double-stranded nucleic acid of the target gene sample is added to the reaction system of the nucleic acid probe and the gene sample. Then, an external voltage is applied to the reaction system to which the aforementioned intercalating agent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/53C12Q1/68G01N37/00C12N15/09
CPCC12Q1/6825C12Q2565/607C12Q2563/173C12Q2563/113C12Q2523/101
Inventor 前田瑞夫秋元克美堀淳一村山隆亮田畑仁平板东克彦
Owner PANASONIC CORP
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More