Novel gene and protein encoded by the gene

a gene and gene technology, applied in the field of recombinant polypeptides, can solve the problems of insufficient reliability of model predictive abilities, and achieve the effect of identifying and purifying proteins

Inactive Publication Date: 2006-03-23
PROTEIN EXPRESS +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0087] Further, polypeptide chip prepared by arraying the polypeptides of the present invention can be a strong tool for functional analysis on the e...

Problems solved by technology

However, these models' predictive ab...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0093] The present invention will now be further described by means of examples that are not intended to limit the present invention. The various gene manipulations employed in the examples are according to the methods described in the above Current Protocols in Molecular Biology (edited by Frederick M. Ausubel et al., 1987).

(1) Construction of cDNA Library Derived from Human Adult Whole Brain, Human Adult Hippocampus and Human Embryonic Whole Brain

[0094] Double-stranded cDNA was synthesized using an oligonucleotide having Not-I site (GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15) (Invitrogen) as a primer, mRNAs (Clontech) derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain as templates, and a SuperScriptII reverse transcriptase kit (Invitrogen). Next, an adaptor (Invitrogen) having SalI site was ligated to the cDNA, followed by digestion with NotI and 1% low-melt agarose electrophoresis. Thus, DNA fragments of 3 kb or more were purified...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Volumeaaaaaaaaaa
Volumeaaaaaaaaaa
Fractionaaaaaaaaaa
Login to view more

Abstract

Novel DNAs containing the regions which encode proteins have been directly cloned from cDNA libraries derived from the human adult whole brain, the human adult hippocampus and the human embryonic whole brain, the nucleotide sequences thereof have been determined, and their functions have been identified. The present invention provides DNA which comprises the nucleotide sequence encoding the following polypeptide (a) or (b): (a) a polypeptide comprising an amino acid sequence which is identical or substantially identical to an amino acid sequence represented by any one of SEQ ID NOS: 1 to 70; (b) a polypeptide comprising an amino acid sequence derived from the amino acid sequence represented by any one of SEQ ID NOS: 1 to 70 by deletion, substitution or addition of a section of amino acids, and having biological activity which is substantially the same characteristic with the function of the polypeptide of (a); a recombinant polypeptide, which is encoded by the above DNA; and a protein containing the polypeptide.

Description

TECHNICAL FIELD [0001] The present invention relates to DNA and a gene containing the DNA, and a recombinant polypeptide encoded by the DNA and a novel recombinant protein containing the polypeptide. BACKGROUND ART [0002] An enormous amount of information on the nucleotide sequence of the human genome has been obtained by large-scale sequencing in the Human Genome Project and analysis of the information is continuing on a daily basis. [0003] The ultimate goal of the Human Genome Project is not just simple determination of the entire nucleotide sequence of the genome, but also the elucidation of various human life phenomena based on the structural information, that is the nucleotide sequence information of DNA. [0004] Only limited regions of the human genome sequence encode proteins. Currently, the coding regions are predicted by the neural network or an information science technique, called the Hidden Markov Model. However, these models' predictive abilities are not yet sufficiently...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C07H21/02C12P21/06C12M1/34C07K14/47C07K16/18A61P13/08A61P15/00A61P35/00C12N15/12
CPCC07K14/47A61K2039/505A61P13/08A61P15/00A61P35/00
Inventor OHARA, OSAMUNAGASE, TAKAHIRONAKAJIMA, DAISUKE
Owner PROTEIN EXPRESS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products