Promoters and proteins from Clostridium thermocellum and uses thereof

a technology of clostridium thermocellum and promoters, applied in the field of nucleic acid promoters and proteins, can solve the problems of limiting conversion yield, complicated task of elucidating the regulatory mechanism, and long list of cellulosomal genes

Inactive Publication Date: 2006-05-18
UNIVERSITY OF ROCHESTER
View PDF3 Cites 95 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The present invention relates to a new nucleic acid promoter that can be used to direct the expression of proteins or polypeptides in a host. This promoter is isolated from a specific strain of bacteria called Clostridium thermocellum and has been shown to be effective in directing expression in a variety of host organisms. The invention also includes a nucleic acid construct containing this promoter and a nucleic acid molecule encoding a protein or polypeptide, as well as a method for inducing in vivo expression of a protein or polypeptide in a host. The use of this promoter and these constructs can lead to increased efficiency and accuracy in the production of proteins or polypeptides from biomass.

Problems solved by technology

Furthermore, tremendous amounts of cellulose are available as municipal and industrial wastes which today contribute to pollution problems.
The major obstacle to an economic process is the production of the side-products, acetate and lactate, which limits conversion yield.
The task of elucidating the regulatory mechanism is obviously complicated by the large number of the genes and proteins involved.
The long list of the cellulosomal genes is further complicated by many non-cellulosomal cellulase components produced by this bacterium.
The shear number of the genes involved in cellulose degradation suggests that regulation of cellulase biosynthesis in this bacterium is complicated.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoters and proteins from Clostridium thermocellum and uses thereof
  • Promoters and proteins from Clostridium thermocellum and uses thereof
  • Promoters and proteins from Clostridium thermocellum and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

Cloning of glyR3 Nucleic Acid Molecule

[0105] A set of primers were synthesized (Invitrogen, Carlsbad, Calif.) to amplify the glyR3 gene, as well as, to add EcoRV and XhoI restriction sites for cloning: (SEQ ID NO:8) glyR3-F-EcoRV-GCGCGATATCACCAGTGAAGAAATAGCAAAATTA; (SEQ ID NO:9) glyR3-R-XhoI-GCGCCTCGAGGAATTCCAAAGCCCTCTTGGTT

[0106] Polymerase chain reaction (PCR)was utilized using genomic C. thermocellum DNA as a template. Extensor Hi-Fidelity PCR Enzyme (ABgene) was the polymerase of choice due to its ability to accurately amplify longer DNA products. The standard Extensor protocol was followed with the exception of an 80 second PCR extension time. The PCR product was run on a 1% agarose gel with a molecular weight marker to verify the correct size. Next, the PCR product was digested with EcoRV and XhoI. The PTXB 1 plasmid was digested with NruI and XhoI. The products of the digestions were ligated. The ligation product was transformed by electroporation (Bio-Rad, Hercules, Calif. ...

example 2

Expression and Purification of Recombinant Protein

[0107] PTXB 1 containing the glyR3 insert was transformed by electroporation into E. Coli BL21DE3. cells. The cells were grown to a density of 0.8 (OD 600), then 50 mM IPTG was added to the culture. After inducing the expression of rGlyR3 with IPTG, the culture was allowed to incubate in a shaker at 37° C. for 4 hours. At 4 hours, the culture was centrifuged at 5,000 g for 5 minutes and the supernatant decanted. The New England Biolabs (NEB) IMPACT system protein purification protocol was followed. The cells were resuspended in column buffer (20 mM HEPES, 500 mM NaCl, and 1 mM EDTA) and then sonicated for cell lysis. The sonicated product was centrifuged and the supernatant was added to chitin beads (NEB) at room temperature for 1 hour. The chitin beads were washed with 200 ml of column buffer at a flow rate of 2 ml / min. Next, the beads were incubated with 100 mM DTT at 4° C. overnight. The resulting flow-through was concentrated us...

example 3

Creating DNA Probes for EMSA

[0108] Probes for EMSA were created using PCR with Thermostart Taq (ABgene) as a polymerase. The standard Thermostart protocol was used with varying extension times (1 kb / minute rule always followed) and different annealing temperatures (57° C.-62° C.). Primers were synthesized with a 5′ biotin label by Invitrogen (Carlsbad, Calif.). Primers (5′-3′) used:

(SEQ ID NO:10)entire_celCProm-F-biotin:- CCGAATAAAAACTGGACAGAG;(SEQ ID NO:11)Entire_celCProm-R-unlab:- TCCTCCTGAAATATTGTGTTTTA(SEQ ID NO:12)celCProm_1st_100bp-R-unlab:-TGAAACCATTTAACACTGGATTAT(SEQ ID NO:13)celCProm_2nd_100bp-F_biotin-GTTTACGATTTCAAATGTTTATATC.

[0109] For probes that contained just the 18 bp binding site, complementary DNA fragments were synthesized and annealed by heating to 94 C and then cooling:

(SEQ ID NO:14) BS-F-Biotin- AATGAACGCGCGTACATT(SEQ ID NO:15) BS-R-Unlab- AATGTACGCGCGTTCATT

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
timeaaaaaaaaaa
extension timeaaaaaaaaaa
Login to View More

Abstract

The present invention relates to an inducible and a high expression nucleic acid promoter isolated from Clostridium thermocellum. These promoters are useful for directing expression of a protein or polypeptide encoded by a nucleic acid molecule operably associated with the nucleic acid promoters. The present invention also relates to nucleic acid constructs including the C. thermocellum promoters, and expression vectors and hosts containing such nucleic acid constructs. The present invention also relates to protein isolated from Clostridium thermocellum, including a repressor protein. The present invention also provides methods of using the isolated promoters and proteins from Clostridium thermocellum, including methods for directing inducible in vitro and in vivo expression of a protein or polypeptide in a host, and methods of producing ethanol from a cellulosic biomass.

Description

[0001] This application claims benefit of U.S. Provisional Patent Application Ser. Nos. 60 / 626,686, filed Nov. 10, 2004, and 60 / 626,661, filed Nov. 10, 2004, which are hereby incorporated by reference in their entirety.FIELD OF THE INVENTION [0002] The present invention relates to nucleic acid promoters and proteins isolated from C. thermocellum associated with cellulase synthesis, and uses thereof. BACKGROUND OF THE INVENTION [0003] Of all the energy sources available to mankind today, the most plentiful and probably most under-utilized is the energy from the sun that is converted by plants via photosynthesis and stored as a carbon source. (Demain et al., “Cellulase, Clostridia and Ethanol,”Micro Mol Biol Rev 69(1):124-154 (2005)). On a worldwide basis, terrestrial plants produce 1.3×103 metric tons (dry weight basis) of wood, which is equivalent to 7×109 metric tons of coal, or about two-thirds of the world's energy requirement. (Demain et al., “Cellulase, Clostridia and Ethanol,”...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12P7/06C07H21/04C12P21/06C12N9/24C12N9/42C12N15/74C12N1/21
CPCC07K14/33C12P7/06Y02E50/17Y02E50/10
InventorWU, J.H.NEWCOMB, MICHAEL
OwnerUNIVERSITY OF ROCHESTER