Methods for identifying cell surface receptor protein modulators

a cell surface receptor and protein technology, applied in the field of methods for identifying cell surface receptor protein modulators, can solve the problems of changing ion permeability and electrical potential in the postsynaptic cell, the limited use of currently available mglur agonists and antagonists, and the generation of data by conventional high-throughput systems

Inactive Publication Date: 2006-12-07
MERCK & CO INC
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0030] In accordance with the above, the present invention provides functional assays for identifying pharmaceutically effective compounds that specifically interact with and modulate the activity of a target cell surface receptor of a cell. The methods of the invention will find use in identifying modulators. The compounds can be tested in these assays singly or, more preferably, in libraries of compounds, which effectively allows for rapid screening of large panels of compounds.
[0034] On one hand, endogenous second messenger generation e.g., calcium mobilization or phospholipid hydrolysis or increased transcription of an endogenous gene can be detected directly. Alternatively, the use of a reporter or indicator gene can provide a convenient readout. By whatever means measured, a change, e.g., a statistically significant change in the detection signal can be used to facilitate isolation of those cells from the mixture which have received a signal via the target receptor, and thus can be used to identify novel compounds which function as receptor agonists or antagonists.
[0054] The assays of the invention are particularly suitable for an HTS format, which allows the proposed HTS format to test the action of a drug candidate upon a group of cells. The novel HTS system of the present invention can provide improved efficiency over current HTS methods since the vast majority of the cells produce endogenous glutamate which, in turn, effectively interferes with the end result. The presence of the glutamate transporter effective eliminates or quenches endogenous glutamate produced by the cell, thereby effectively reducing the signal to noise ratio and improving the overall sensitivity of the assay.
[0061] These aspects of the invention, as well as others described herein, can be achieved by using the methods and compositions of matter described herein. To gain a full appreciation of the scope of the invention, it will be further recognized that various aspects of the invention can be combined to make desirable embodiments of the invention. For example, the invention includes a method of identifying compounds that modulate active genomic polynucleotides operably linked to a protein with β-lactamase activity that can be detected by FACS using a fluorescent, membrane permeant β-lactamase substrate. Such combinations result in particularly useful and robust embodiments of the invention.

Problems solved by technology

This typically causes a change in ion permeability and electrical potential in the postsynaptic cell.
However, a large body of evidence compels the conclusion that the currently available mGluR agonists and antagonists may be of limited use, both as research tools and potential therapeutic agents, as a result of their lack of potency and selectivity.
However, data generated by conventional high-throughput systems for measuring, for example, glutamate mediated signal transduction are contaminated by endogenous glutamate, which is produced and secreted from cultured cells.
It is believed that this endogenous glutamate interferes with the ability to measure a true functional response of metabotropic glutamate receptors coupled to a reporter gene system.
While the mainstream of the pharmaceutical industry is moving to solve HTS throughput problems, e.g., by developing multi-well plates with more, and thus smaller, individual wells per plate, current models are still plagues by high-basal levels of reporter gene expression.
This drawback is in addition to the expenditure of untold millions of dollars to achieve probably less than an order of magnitude increase in speed without other significant technological advantages which would increase the information content of the screening process.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods for identifying cell surface receptor protein modulators
  • Methods for identifying cell surface receptor protein modulators
  • Methods for identifying cell surface receptor protein modulators

Examples

Experimental program
Comparison scheme
Effect test

example 1

CLONING OF mGLAST

[0271] The full-length cDNA of mouse GLAST was isolated by PCR from a Marathon-Ready mouse brain cDNA library (Clontech, Palo Alto, CA). A 1725 bp fragment was amplified by PCR using Pfu Turbo DNA Polymerase with the following cycling conditions: a 2 min pre-incubation at 95° C., followed by 35 cycles of 95° C. for 30 sec., 56° C. for 30 sec., and 72° C. for 3 min. This fragment was obtained using the N-terminal primer, (5′GCCACCATGACCAAAAGCAACGGAGA 3′) containing an optimized Kozak sequence (GCCACC) and the C-terminal primer (5′ GAAAGTGAGCCCAGGGAGAT 3′) resulting in the inclusion of 80 basepairs of 3′ untranslated region. The amplified fragment was cloned into the PCR-Blunt II-Topo vector (Invitrogen, Carlsbad, Calif.). Following confirmation of the DNA sequence, the entire coding sequence of the gene was excised by EcoRI and sub-cloned into the mammalian expression vector pIRESneo2 (Invitrogen, Carlsbad, Calif.).

Generation of Stable Cell Lines Co-Eexpressing m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lag timeaaaaaaaaaa
pHaaaaaaaaaa
volumeaaaaaaaaaa
Login to View More

Abstract

The present invention makes available a rapid, effective assay for screening and identifying pharmaceutically effective compounds that specifically interact with and modulate the activity of a target cell surface protein, e.g., a receptor or ion channel. The subject assay enables rapid screening of large numbers of compounds to identify those which modulate the bioactivity of the cellular proteins. The subject assays are particularly amenable for high throughput formats and are particular useful in identifying modulators of a mammalian metabotropic glutamate receptor protein.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Provisional Application No. 60 / 486,639, filed Jul. 11, 2003, the contents of which are incorporated herein by reference in their entirety.BACKGROUND OF THE INVENTION [0002] In the mammalian central nervous system (CNS), the transmission of nerve impulses is controlled by the interaction between a neurotransmitter, that is released by a sending neuron, and a surface receptor on a receiving neuron, causing excitation of this receiving neuron. Of the approximately 20 naturally-occurring amino acids that are the basic building blocks for protein biosynthesis, certain amino acids, notably glutamate, are also used as signaling molecules in higher organisms such as man. In fact, glutamate, a member of a broad class of excitatory amino acids, is the transmitter of the vast majority of the excitatory synapses in the mammalian central nervous system (CNS) and plays an important role in a wide variety of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): G01N33/567G01N33/53G01NG01N33/50G01N33/68G01N33/94
CPCG01N33/5008G01N33/502G01N33/5032G01N2333/70571G01N33/5041G01N33/6872G01N33/9406G01N33/5038
InventorJACOBSON, MARLENE A.WANG, RUIPING
OwnerMERCK & CO INC