Lectin-derived progenitor cell preservation factors and methods of use

a technology of progenitor cells and preservation factors, applied in the field of nuclear acid, can solve the problems of inability to easily be clinically applied, no known cytokines alone or in combination can preserve the viability of primitive progenitors in liquid culture without stromal support, and the efficiency of transfection is not easily determined. , to achieve the effect of increasing the level of total body irradiation, increasing the targeting efficiency, and determining the efficiency of transfection

Inactive Publication Date: 2007-12-06
IMCLONE SYSTEMS +1
View PDF16 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0087] It is a further advantage of the invention that it enables preservation of cells for periods and under conditions that permit shipment of cells, e.g., by mail, to distant locations for transplantation.

Problems solved by technology

Soluble regulators and cell-cell interactions mediate differentiation pathways of immature progenitors through a tightly-controlled but inadequately understood process.
No known cytokines alone or in combination can preserve viability of primitive progenitors in liquid culture without stromal support beyond a few days.
While the use of stromal cell culture has heretofore proven to be useful for the maintenance of hematopoietic stems cells in the laboratory setting, such approaches are not easily amenable to clinical application.
Isolating and establishing stromal cell cultures for individual patients is not practical either because of time constraints or because a patient's marrow may be compromised by the underlying disease or exposure to agents (e.g., radiation, chemotherapy) that can damage the bone marrow microenvironment.
No lectin has yet been successfully developed as a human therapeutic.
In view of the above considerations, it is clear that regulation of the hematopoietic process remains incompletely understood.
Soluble regulators that maintain or expand primitive progenitors for extended periods in the absence of stromal support are not yet commercially available.
As a consequence, numerous potential therapeutic approaches to diseases such as cancer and genetic blood diseases remain unexplored.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lectin-derived progenitor cell preservation factors and methods of use
  • Lectin-derived progenitor cell preservation factors and methods of use
  • Lectin-derived progenitor cell preservation factors and methods of use

Examples

Experimental program
Comparison scheme
Effect test

example 1

RNA Isolation and cDNA Synthesis

[0132] Total RNA was prepared from mid-maturation Dolichos lab lab seeds stored at −70° C. following the procedure of Pawloski et al. (1994). Poly(A+) RNA was obtained from this total RNA using the PolyATract mRNA Isolation System (Promega) according to the manufacturer's instructions. Avian myeloblastosis virus reverse transcriptase (Promega) was used to generate cDNA from 0.5 μg poly(A+)RNA, or from 3.0 μg of total RNA, using 1 μg of oligo(dT) in standard reaction conditions (Sambrook et al. 1989).

Polymerase Chain Reaction and cDNA Cloning

example 2a

[0133] Based on the amino acid sequence published by Gowda et al. (1994), two degenerate oligonucleotide primers were designed using Phaseolus codon usage (Devereux et al. 1984):

MLAAA (AG) TT (TC) GA (TC) CC (AT) AA(SEQ ID NO:3)(TC) CA (AG) GA (AG) GAMLZTT (AT) CC (AG) TT (TC) TGCCA (AG)(SEQ ID NO:4)TCCCA

[0134] A 500+ bp product was amplified from cDNA prepared as described in Example 1, by 30 cycles of polymerase chain reaction (PCR), each cycle comprising 40 s at 94° C., 40 s at 50° C., 60 s at 72° C., followed by an extension step at 72° C. for 10 min. Reactions were performed in 50 μL containing 30 pmol of each primer, 0.2 mM deoxyribonucleotides and 0.5 unit of AmpliTaq polymerase (Perkin Elmer) in the corresponding buffer.

[0135] The 500 bp product obtained by PCR was cloned in the cloning vector, pCR2.1 (Invitrogen), and sequenced by sequenase dideoxy chain termination (United States Biochemicals) using the following primers:

GTACCGAGCTCGGAT(SEQ ID NO:5)TCTAGATGCATGCTCGAG(...

example 2b

[0136] Based on the sequence of the FRILa amplified product, a specific primer was prepared:

MLXGTTGGACGTCAATTCCGATGTG(SEQ ID NO:7)

[0137] A degenerate primer corresponding to the first five amino acids of the sequence published by Gowda et al. (1994) was also prepared:

MLIGC (TC) CA (AG) TC (TC) CT (TC) TC(SEQ ID NO:8)(TC) TT

[0138] The MLX and MLI primers were used in combination to amplify a 480 bp product from cDNA prepared as in Example 1, through 30 PCR cycles using the same conditions described above. This secondary amplified fragment was cloned in the pCR2.1 vector and sequenced as described above, and was designated “FRILb.”

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Therapeuticaaaaaaaaaa
Cytotoxicityaaaaaaaaaa
Affinityaaaaaaaaaa
Login to View More

Abstract

The invention relates to an isolated nucleic acid molecule that encodes a protein that is effective to preserve progenitor cells, such as hematopoietic progenitor cells. The nucleic acid comprises a sequence defined by SEQ ID NO:1, a homolog thereof, or a fragment thereof. The encoded protein has an amino acid sequence that comprises a sequence defined by SEQ ID NO:2, a homolog thereof, or a fragment thereof that contains an amino acid sequence TNNVLQVT. Methods of using the encoded protein for preserving progenitor cells in vitro, ex vivo, and in vivo are also described. The invention, therefore, include methods such as myeloablation therapies for cancer treatment wherein myeloid reconstitution is facilitated by means of the specified protein. Other therapeutic utilities are also enabled through the invention, for example, expanding progenitor cell populations ex vivo to increase chances of engraftation, improving conditions for transporting and storing progenitor cells, and facilitating gene therapy to treat and cure a broad range of life-threatening hematologic diseases.

Description

BACKGROUND OF THE INVENTION [0001] The invention relates to a nucleic acid and its corresponding protein for use in connection with the preservation of progenitor cells. More specifically, the invention relates to a nucleic acid and the protein that it encodes and which is capable of preserving progenitor cells, as well as a method of using the protein for preserving progenitor cells. [0002] Each day the bone marrow generates and releases into the circulation several billion fully-differentiated, functional blood cells. Production of these cells derives from a small stock of quiescent progenitor cells (including the most primitive stem cells and other less primitive but still immature progenitors) by a process called hematopoiesis (Zipori 1992). The most primitive stem cells have the capacity to generate >1013 cells containing all blood lineages (Turhan et al. 1989). The production of such a large number of cells is achieved by extensive proliferation coupled with successive diff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/20A61K35/12C07H21/00C12N5/00A61K38/16C12N15/09C07K14/42C12N5/0789C12N5/10C12N15/90
CPCA61K38/00A61K2035/124C07K14/42C12N2501/59C12N15/90C12N2501/26C12N5/0647A61P39/00
InventorCOLUCCI, M. GABRIELLACHRISPEELS, MAARTEN J.MOORE, JEFFREY G.
OwnerIMCLONE SYSTEMS