Tumour antigen protein and tumour antigen peptide

A tumor antigen peptide, tumor antigen technology, applied in the field of tumor antigen protein and tumor antigen peptide for the treatment of liver cancer, can solve the problems of low survival rate, poor effect and prognosis of liver cancer patients, and achieve the effect of preventing and treating tumor cell metastasis

Inactive Publication Date: 2008-06-11
PEKING UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the treatment effect and prognosis are often poor, and the one-year and five-year survival rates of patients with liver cancer are very low compared with the survival rates of other types of tumor patients.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumour antigen protein and tumour antigen peptide
  • Tumour antigen protein and tumour antigen peptide
  • Tumour antigen protein and tumour antigen peptide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1, cDNA microarray (cDNA microarray) analysis

[0029] In order to find the genes differentially expressed in liver cancer tissues and adjacent tissues, we analyzed the differential expression of more than 18,000 genes in liver cancer tissues and adjacent tissues using the commercially available AFFYMETRIX human genome U-133A chip. In the data analysis, we found that a testis-specific gene TSPY was highly expressed in liver cancer tissues. The accession number of the TSPY gene in the gene library was TSPYNM 003308, which had the nucleotide sequence shown in Sequence 2.

Embodiment 2

[0030] Embodiment 2, analyze the expression of TSPY gene with the method for RT-PCR

[0031] cDNA of 16 commercial human normal tissues from the biotechnology company CLONTECH (spleen, prostate, testis, ovary, small intestine, large intestine, autocytic cells, heart, lung, liver, brain, kidney, pancreas, placenta, skeletal muscle, thymus) , cDNA from cancer tissues and matched paracancerous tissues of 57 liver cancer patients, cDNA from 19 renal cancer tissues and matched paracancerous tissues, and cancer tissues and paired paracancerous tissues from 13 lung cancer patients The cDNA of the tissue, the cDNA of the cancer tissues and the paired adjacent tissues of 10 gastric cancer patients, and the cDNA of the cancer tissues and the matched adjacent tissues of 8 bladder cancer patients were used to detect the expression of TSPY gene in normal tissues and normal tissues. expression in tumor tissues.

[0032] Conditions for RT-PCR in the present invention: DNA polymerase from Sh...

Embodiment 3

[0033] Embodiment 3, in situ hybridization

[0034] In order to confirm the cell localization of TSPY and further prove the correlation between the gene and liver cancer, in situ hybridization was carried out with paraffin sections of liver cancer tissues.

[0035] The PCR product amplified with the upstream primer CAGGGCTTCTCATTCCACTC and the downstream primer CCATCATATTCAACTCAACAACTGG was constructed into a plasmid (the standard plasmid in Real time PCR), and the sequence was confirmed to be correct. Sense and antisense RNA probes were labeled with DIG RNA labeling Kit (T7 / SP6) (Roche) according to the kit instructions.

[0036] The brief operation steps are as follows: Prepare 6 μm thick paraffin sections, after dewaxing and hydration treatment, treat with 0.2M hydrochloric acid at room temperature for 10 minutes, wash with PBS for 2×5 seconds, digest with 20 μg / ml proteinase K at 37°C for 30 minutes . Wash 2 x 5 sec with PBS and fix with 4% paraformaldehyde for 10 min. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A tumor antigen protein and its tumor antigen peptide used to prepare the medicine for treating liver cancer are disclosed. Said tumor antigen protein can generate the peptide fragment by cell endolysis. Said peptide fragment can bind with the (MHC)-I molecular compatible with main tissue and can be recognized by T cells. The DNA sequence coding said tumor antigen protein has the nucleotide sequence TSPYNM 003308 in GenBank.

Description

technical field [0001] The invention relates to a tumor antigen protein and a tumor antigen peptide, in particular to a tumor antigen protein and a tumor antigen peptide for treating liver cancer. Background technique [0002] The occurrence of tumor is related to the immune state of the body. Cancer patients are often accompanied by hypofunction of cellular immunity, and cellular immunity plays a major role in clearing tumors. The immunogenicity of tumors is weak and cannot induce the body to produce antibodies sufficient to resist tumors. Some tumor products have an immunosuppressive effect on the host, so it is difficult for the immune system of tumor patients to launch a powerful attack on the tumor. Anticancer drugs are generally immunosuppressants, which reduce the immunity of patients while treating tumors. Radiotherapy and chemotherapy are not only difficult to cure tumors but also lead to the occurrence of second tumors. Therefore, in the treatment of malignant tu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435C07K14/47A61K39/00A61K38/17A61P35/00C12N15/12
Inventor 陈慰峰尹艳慧李云燕
Owner PEKING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap