Supercharge Your Innovation With Domain-Expert AI Agents!

Refractory metal prolease gene engineering bacterium and acquiring method therefor

A technology of metalloprotease and high temperature resistance, applied in genetic engineering, microorganism-based methods, plant gene improvement, etc., can solve the problems of low enzyme activity, unstable enzyme production, stable expression of high temperature resistance, etc., and achieve easy purification Effect

Inactive Publication Date: 2011-01-12
THE INST OF MICROBIOLOGY XINJIANG ACADEMY OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Aiming at the characteristics of unstable enzyme production, low enzyme activity, and unstable expression of high temperature resistant metalloprotease strains at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Refractory metal prolease gene engineering bacterium and acquiring method therefor
  • Refractory metal prolease gene engineering bacterium and acquiring method therefor
  • Refractory metal prolease gene engineering bacterium and acquiring method therefor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] Example 1: Amplification and validation of Bacillus Licheniformis CGMCC NO0800 high-temperature metalloprotease.

[0076] By designing a pair of primer sequences: EMP1 ATA CGG GTG GTT GAC ACT

[0077] EMP2 ACA TGA ATA TGG CTA GTT TGC

[0078] Using the chromosome of XJT9503 bacteria as a template, a 1005bp fragment EMP was amplified by PCR, and the PCR reaction was carried out in a 50μl system. Take 1 μl of DNA extracted by XJT9503 as a template, add 20 μl of sterilized deionized water, 25 μl of Taq enzyme mixed solution, EMP12 μl (25 pmol), EMP22 μl (25 pmol), and amplify the high-temperature neutral protease gene in a PCR automatic cycler. The cycle parameters are : Denaturation at 94°C for 5min, 1min at 94°C, 1min at 55°C, 2min at 72°C, 30 cycles, and finally extension at 72°C for 10min, after the cycle, take 5μl PCR product for 1% agarose gel electrophoresis, ethidium bromide After staining, observe under ultraviolet light and analyze PCR pro...

Embodiment 2

[0090] Embodiment 2: Transformation of high temperature resistant metalloprotease gene

[0091] According to the codon preference of yeast, the analysis of the obtained genes found that the codons encoding some amino acids have low expression levels or even zero expression levels. Three pairs of primers were designed to perform site-directed mutagenesis on these codons to transform the genes. See Figure 5 , Figure 6 ;Retrofit scheme see Figure 7 .

[0092] P1: GCACGAATTCATACGGGTGGTTGACACT

[0093] P2: TGTAGTACGGTAGCCGTACCAG

[0094] P3: GGCTACCGTACTACAAACAGCAGC

[0095] P4: GTTACGATAAACAGGCGAGCCGCTTTG

[0096] P5: CCTGTTTATCGTAACTACAGTGATACAGG

[0097] P6: GTACGCGGCCGCACATGAATATGGCATGTTTGC

[0098] Use primers P1, P3 paired, P4, P5 paired, P6, P2 paired with plasmid pMD18-TE as a template for PCR, denaturation at 94°C for 5min, 94°C for 1min, 55°C for 1min, 72°C for 2min, and the number of cycles is 30 , recover the above-mentioned three-stage PCR product, and then ...

Embodiment 3

[0099] Embodiment 3: the construction of yeast expression vector and the acquisition of genetically engineered bacteria containing high temperature resistant metalloprotease gene

[0100] The modified gene was digested with EcorI and NotI and connected with the yeast expression vector pPIC9K vector of EcorI and NotI to construct the vector 9TE. After identification, the sequencing results proved that the gene transformation was successful and the reading frame was correct. See Figure 8 , Figure 9 .

[0101] The constructed yeast expression vector, SacI linearized CIAP dephosphorylated, electrotransformed protease-deficient yeast strain SMD1168, the transformation method is as follows:

[0102] 1. Take a single colony of SMD1168 in 5m1YPD culture medium, shake overnight at 30°C, take 20ul of cultured bacteria into 100ml of YPD culture medium, culture at 30°C until the cell density reaches 1-2A OD 600 . According to the formula 12A OD600=5X10 7 cell / ml Count cells.

[010...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses (pichia pastoris) CGMCC No1622, which can produce metal protease and a manufacturing method of obtaining the bacterial strain. Through designing a DNA primer, 1005 basic group is obtained by using PCR method and increasing from the total DNA of the Bacillus licheniformis XJT9503, and then cloned on the Pmd18-T carrier, after making a sequence analysis and measure to the obtained gene, the high temperature neutral protease gene is EMP, the snatch size is 942 basic group which expresses 314 aminophenol, and a Bacillus subtilis system is made use of validating andaffirming the obtained gene. The present invention provides an effective way for making the extensive ferment and production and improving the output of enzyme.

Description

field of invention [0001] The invention relates to the field of microorganisms and microbial fermentation. Specifically, the present invention relates to a high-temperature resistant metalloprotease genetically engineered bacterium and its obtaining method. Background technique [0002] Metalloproteases are a class of neutral proteases whose active centers are metal ions. As a large class of biological enzymes, proteases are widely used in food, medicine, detergent, textile and leather processing, etc. High-temperature protease has the characteristics and advantages of fast catalytic reaction speed, no industrial pollution, and wide adaptability to catalytic reaction conditions, especially in heat resistance, denaturant resistance, organic solvent resistance, etc., and has important application value. Not only that, the elucidation of the heat-resistant mechanism of high-temperature proteases can also provide a theoretical basis for people to transform natural enzymes by p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/60C12N15/57C12N1/19C12R1/84C12N15/81
Inventor 王玮张志东冯怀蓉张涛谢玉清张伟茆军唐琦勇马东林闫论
Owner THE INST OF MICROBIOLOGY XINJIANG ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More