Unlock instant, AI-driven research and patent intelligence for your innovation.

Yeast engineering bacterium for producing human pepsinogen and its preparation method and application

A pepsinogen and yeast engineering technology, which is applied to the field of yeast engineering bacteria producing human pepsinogen and its preparation, can solve the problem of porcine pepsinogen protein sequencing, purification, expression without data results, and biochemical properties that need further study , shortage of supply of human gastric tissue, etc., to achieve the effect of low production cost, good application value and significant economic benefits

Inactive Publication Date: 2008-03-19
上海华冠生物芯片有限公司 +1
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In China, Qiao Xianfeng et al. reported that the porcine pepsin gene was expressed in Pichia methanolica, but there were no data on the protein sequencing, purification, and expression of the expressed porcine pepsinogen, and the biochemical characteristics still need to be further studied.
[0010] In summary, at present, human pepsinogen is mainly isolated and extracted from human gastric tissue, but due to the shortage of human gastric tissue supply and unresolved blood contamination, it is difficult to It is difficult to achieve industrialization, which greatly limits its development and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yeast engineering bacterium for producing human pepsinogen and its preparation method and application
  • Yeast engineering bacterium for producing human pepsinogen and its preparation method and application
  • Yeast engineering bacterium for producing human pepsinogen and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1 constructs recombinant PGC expression plasmid

[0048] Using the reverse-transcribed cDNA of human stomach tissue total RNA as a template, the natural PGC gene fragment was amplified by PCR, and enzyme cutting sites XhoI and NotI were introduced into the 5' end and 3' end of the PGC gene coding sequence respectively. The secretory expression vector pPIC9k (purchased from Invitrogen) of P. pastoris was loaded to obtain a recombinant expression plasmid (see FIG. 1 ).

[0049] (1) The primer sequence for cloning the natural PGC gene fragment is:

[0050] 5' direction primer: GCAGTGGTCAAAGTGCCCCTG (SEQ ID NO: 1)

[0051] 3' direction primer: CTAGGCGGCAGTGGCAAAGC (SEQ ID NO: 2)

[0052] (2) The primer sequence of the pPIC9K expression vector is:

[0053] 5' direction primer

[0054] (GACCCAAT)CTCGAG(xhoI site)GCAGTGGTCAAAGTGCCCCTG (SEQ ID NO: 3)

[0055] 3' Direction Primer

[0056] (GT) GC GGC CGC (NotI site) TTA (stop codon) GGCGGCAGTGGCAAAGC (SEQ ID NO:...

Embodiment 2

[0057] Example 2 Electrotransformation of recombinant expression plasmid Pichia methanolica GS115

[0058] The constructed expression plasmid pPIC9k-pgc was digested with SalI and linearized. The host strain P. pastoris GS115 (His mut+) purchased from Invitrogen was cultivated to OD of 1.6-1.8 to prepare electrocompetent cells, mixed with the aforementioned linearized plasmid, and then electrotransformed with a Biorad electrotransformer, wherein the voltage was 1500V, and the capacitance 50PF, resistance 4kg, add 0.5mmol / L cold sorbitol to the transformation cup, take 200μ1 and spread it on MD plate, culture at 30℃ until a single colony appears, and more than 1000 transformants are obtained as a result.

Embodiment 3

[0059] Example 3 Screening of recombinant strains of highly resistant Pichia methanolica

[0060] More than 1,000 transformants were successively spread on YPD plates containing 1mg / L, 2mg / L, 3mg / L, and 4mg / L of G418, and cultured at 28-30°C. As a result, 22 a transformant. The YPD preparation used is: 20 g of peptone, 10 g of yeast extract, and 20 g of glucose are dissolved in 0.9 L of water, and the volume is made up to 1 L with water, and then autoclaved.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a yeast engineering strain which can produce the human pepsinogen, the yeast strain is microzyme which is converted through a eukaryotic expression vector, and the eukaryotic expression vector contains the protogene of the human pepsinogen. The present invention also discloses the preparation method and the application of the yeast engineering strain. The yeast engineering strain of the present invention realizes the highly effective secretion expression of the human pepsinogen zymogen C in a methylotrophic yeast pichia pastoris, the expression quantity is above 600 mg / L, the recombination PGC of the present invention is consistent to the immunogenicity and the proteinase activity of the PGC abstracted from human gorge tissue, thus the present invention can be widely applied to a plurality of fields such as medicine, food and chemical engineering, etc., and have extremely good application value and market prospect.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a yeast engineering bacterium producing human pepsinogen and its preparation method and application. Background technique [0002] Pepsinogen (pepsinogen, PG) is the precursor of pepsin in gastric juice, the molecular weight of the protein is about 43kD, and it is composed of 300 amino acids. According to different biochemical and immunological characteristics, it can be divided into two major subgroups, PGI (also known as PGA) and PGII (also known as PGC). Pepsinogen A (PGA) is derived from the principal cells and cervical mucus cells of the fundic glands, and pepsinogen C (PGC) (Genbank No. NM_002630) is derived from the whole gastric glands (gastric cardia glands, fundic glands, ) and Brunner's glands in the distal duodenum, the prostate and pancreas also produce a small amount of PGC, and the synthesis of PGC in the gastric mucosa is about 25% of the total. Most of t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12N15/57A61K38/48A61P1/04C12R1/84
Inventor 徐晓晶宋大新金维荣
Owner 上海华冠生物芯片有限公司