Human keratinized cell growth factor-1 analogue preparation method and application thereof
A technology for keratinocytes and growth factors, applied in the field of genetic engineering, can solve problems such as being expensive, time-consuming, unable to obtain satisfactory KGF output, and achieve the effects of increasing activity, reducing costs, and improving production efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] 1. Gene design and synthesis
[0023] 1 Gene synthesis of Δ23KGF(40S):
[0024] According to the nucleotide sequence of human KGF1 (SEQ ID No.5) on the NCBI website, its amino acid sequence consists of 163 amino acids as shown in (SEQ ID No.6). 13 primers were designed and synthesized using DNAStar software, and the recursive PCR method was used. Synthesize the entire gene sequence of KGF, and design a pair of primers at both ends of KGF to synthesize Δ23KGF, then design a pair of primers at position 40, and mutate cysteine to serine to obtain Δ23KGF(40S). And remove the sites of NdeI and BamH I contained inside. In the artificial synthesis, the preferred codons of Escherichia coli were selected to improve the recombinant expression level.
[0025] F1 (SEQ ID No. 9):
GACATACCCGTAGCTATGATTATATGGAAGGTGGTGATATTCGTGTGCGTCGTCTGTTT
(79-137)
F2(SEQ ID No.10):
AACAGATGGCGACGAATGTGAATTGCAGCAGCCCAGAAAGACATACCCGTAGCTATGA
T(40-98)
F3(SEQ ID No.11):
AC...
Embodiment 2
[0084] PCR reaction conditions: pre-denaturation at 94°C for 3 minutes into the cycle, cycle conditions: 94°C, 45s; 59°C, 45s; 72°C, 51s, a total of 28 cycles, then 72°C extension for 10 minutes, and finally cooling to 4°C. Using 1% agarose gel electrophoresis detection, using TaKaRa's Agarose Gel DNA Purification kit to recover the target DNA fragment, the synthesis of SUMO-KGF-1Δ23 (40-S) is composed of 753 bases, of which the 5'end contains Nde I enzyme Cut site, 3'end contains terminator and BamH I restriction site. After inserting the SUMO-KGF-1Δ23(40-S) fragment into the sequencing plasmid PET-3C, it was completed by Shanghai Shengong and the sequencing was correct. Example 2 Construction of recombinant plasmid of pET-ULP1
[0085] SEQ ID NO: 26: Ulp-F1 (5’-3’, 59 bases in total)
[0086] SEQ ID NO: 27: Ulp-F2 (5’-3’, 59 bases in total)
[0087] SEQ ID NO: 28: Ulp-F3 (5’-3’, 59 bases in total)
[0088] SEQ ID NO: 29: Ulp-F4 (5’-3’, 59 bases in total)
[0089] SEQ ID NO: 30: ...
Embodiment 3
[0109] Example 3 Construction of the co-expression recombinant plasmid of SUMO-KGF-1Δ23(40-S) and Ulp1
[0110] The invention is used for soluble expression of human KGF-1 structural analogs. The recombinant protein expression vector includes a first transcription unit expressing a fusion protein composed of a small molecule ubiquitin-related modifier mature peptide and a structural analog of human KGF-1 and a second transcription unit for expressing ubiquitin-related modifier protease , Wherein the first transcription unit and the second transcription unit are connected in series with each other in the same recombinant vector.
[0111] In terms of the tandem connection between the two transcription units, the recombinant expression vector of the present invention first includes a small molecule ubiquitin-related modifier mature peptide that is operably linked to the first promoter and has a similar structure to human KGF-1. The nucleotide sequence of the fusion protein, and an op...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap