Check patentability & draft patents in minutes with Patsnap Eureka AI!

Human keratinized cell growth factor-1 analogue preparation method and application thereof

A technology for keratinocytes and growth factors, applied in the field of genetic engineering, can solve problems such as being expensive, time-consuming, unable to obtain satisfactory KGF output, and achieve the effects of increasing activity, reducing costs, and improving production efficiency

Active Publication Date: 2008-07-16
吉林农大生物反应器工程有限公司
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the solubility and yield of the protein are improved, time-consuming, expensive protease costs and the risk of protease hydrolysis of the target protein often fail to obtain a satisfactory KGF yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human keratinized cell growth factor-1 analogue preparation method and application thereof
  • Human keratinized cell growth factor-1 analogue preparation method and application thereof
  • Human keratinized cell growth factor-1 analogue preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] 1. Gene design and synthesis

[0023] 1 Gene synthesis of Δ23KGF(40S):

[0024] According to the nucleotide sequence of human KGF1 (SEQ ID No.5) on the NCBI website, its amino acid sequence consists of 163 amino acids as shown in (SEQ ID No.6). 13 primers were designed and synthesized using DNAStar software, and the recursive PCR method was used. Synthesize the entire gene sequence of KGF, and design a pair of primers at both ends of KGF to synthesize Δ23KGF, then design a pair of primers at position 40, and mutate cysteine ​​to serine to obtain Δ23KGF(40S). And remove the sites of NdeI and BamH I contained inside. In the artificial synthesis, the preferred codons of Escherichia coli were selected to improve the recombinant expression level.

[0025] F1 (SEQ ID No. 9):

GACATACCCGTAGCTATGATTATATGGAAGGTGGTGATATTCGTGTGCGTCGTCTGTTT

(79-137)

F2(SEQ ID No.10):

AACAGATGGCGACGAATGTGAATTGCAGCAGCCCAGAAAGACATACCCGTAGCTATGA

T(40-98)

F3(SEQ ID No.11):

AC...

Embodiment 2

[0084] PCR reaction conditions: pre-denaturation at 94°C for 3 minutes into the cycle, cycle conditions: 94°C, 45s; 59°C, 45s; 72°C, 51s, a total of 28 cycles, then 72°C extension for 10 minutes, and finally cooling to 4°C. Using 1% agarose gel electrophoresis detection, using TaKaRa's Agarose Gel DNA Purification kit to recover the target DNA fragment, the synthesis of SUMO-KGF-1Δ23 (40-S) is composed of 753 bases, of which the 5'end contains Nde I enzyme Cut site, 3'end contains terminator and BamH I restriction site. After inserting the SUMO-KGF-1Δ23(40-S) fragment into the sequencing plasmid PET-3C, it was completed by Shanghai Shengong and the sequencing was correct. Example 2 Construction of recombinant plasmid of pET-ULP1

[0085] SEQ ID NO: 26: Ulp-F1 (5’-3’, 59 bases in total)

[0086] SEQ ID NO: 27: Ulp-F2 (5’-3’, 59 bases in total)

[0087] SEQ ID NO: 28: Ulp-F3 (5’-3’, 59 bases in total)

[0088] SEQ ID NO: 29: Ulp-F4 (5’-3’, 59 bases in total)

[0089] SEQ ID NO: 30: ...

Embodiment 3

[0109] Example 3 Construction of the co-expression recombinant plasmid of SUMO-KGF-1Δ23(40-S) and Ulp1

[0110] The invention is used for soluble expression of human KGF-1 structural analogs. The recombinant protein expression vector includes a first transcription unit expressing a fusion protein composed of a small molecule ubiquitin-related modifier mature peptide and a structural analog of human KGF-1 and a second transcription unit for expressing ubiquitin-related modifier protease , Wherein the first transcription unit and the second transcription unit are connected in series with each other in the same recombinant vector.

[0111] In terms of the tandem connection between the two transcription units, the recombinant expression vector of the present invention first includes a small molecule ubiquitin-related modifier mature peptide that is operably linked to the first promoter and has a similar structure to human KGF-1. The nucleotide sequence of the fusion protein, and an op...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a human keratinocyte growth factor -1 structure analogues KGF-1delta 23KGF(40S), an N end of an amino acid sequence of which lacks 23 amino acids, while the 40-bit cysteine point of which is mutated into a nonpolar amino acid. The invention also relates to a production method of the structure analogues, which carries out the fusion expression with a small ubiquitin related modifier gene mature peptide, while a fusion protein and the ubiquitin related modifier gene protease 1 co-express in the prokaryotes. In the process of fermentation expression, the ubiquitin related modifier gene protease 1 can hydrolyze the fusion protein to produce a soluble KGF-1delta 23KGF (40S). The human keratinocyte growth factor structure analogues can facilitate the proliferation of the keratinocyte cells, the growth of the hair follicle cells and inhibit the growth of the fibroblast cells, and has the functions of anti-scar, anti-fibrosis, epidermis healing facilitation and corneal wound reparation, etc.

Description

Technical field [0001] The present invention belongs to the technical field of genetic engineering. More specifically, the present invention relates to a human keratinocyte growth factor-1 (Keratinocyte Growth Factor, KGF) structural analog protein, a gene encoding the protein, and a recombinant expression vector containing the gene. The present invention also relates to a method for expressing and producing the structural analogue protein of human keratinocyte growth factor-1 in a soluble form. Background technique [0002] Keratinocyte growth factor (KGF) is a type of peptide growth factor with a wide range of biological activities. It belongs to the FGF family (FGF-7). The role of KGF is mainly to resist fibrosis of liver and lung tissues, promote traumatic tissue damage, Repair and healing of chronic tissue damage (persistent damage in diabetic patients) and venous ulcers (including chronic gastrointestinal ulcers). Studies have shown that systemic administration of KGF is sa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/475C12N15/12A61K38/17A61P27/02A61P17/02A61P17/14
Inventor 李校堃刘孝菊苏志坚
Owner 吉林农大生物反应器工程有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More