Salt-endurance related rice protein kinase gene clone and uses thereof

A technology of protein and salt tolerance, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as unclear MAPK cascade, achieve the effect of improving tolerance and broad application prospects

Inactive Publication Date: 2008-07-23
BEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the OsEDR1-mediated MAPK cascade remains unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Salt-endurance related rice protein kinase gene clone and uses thereof
  • Salt-endurance related rice protein kinase gene clone and uses thereof
  • Salt-endurance related rice protein kinase gene clone and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1. Acquisition of Salt Tolerance Gene OsMAP3Kβ3

[0048] 1. Acquisition of gene sequence

[0049] Using the nucleotide sequence of Arabidopsis MAP3K beta 3 gene (GenBank No.: AJ010092) to search for homologous genes in GENBANK, the homologous sequence of rice (GenBank No.: EAY87678) was obtained. The homologous sequence is located in the rice On the two chromosomes, its CDS is 1572bp, encodes 523 amino acids, has 58% homology with the kinase domain of AtMAP3Kβ3, and has 11 subdomains of protein kinases. It is speculated that it is a MAP3K gene in rice and named is OsMAP3Kβ3.

[0050] 2. PCR amplification and sequence analysis of OsMAP3Kβ3

[0051] Primers were designed according to the coding region of OsMAP3Kβ3 sequence in GENBANK, and OsMAP3Kβ3 was amplified by PCR method using the rice Guanglu dwarf cDNA as a template. The primer sequences are as follows:

[0052] Forward primer: 5'>CACCATGGCGGCGCGCCAGCGG>3;

[0053] Reverse primer: 5'>CCGCTGTATCATGGCAAG...

Embodiment 2

[0056] Example 2, Obtaining of transgenic rice of OsMAP3Kβ3 gene related to salt tolerance in rice

[0057] Using the Agrobacterium-mediated method to transform rice with the gene OsMAP3Kβ3 related to salt tolerance obtained in Example 1, the specific method is as follows:

[0058] 1) Transformation of Agrobacterium

[0059] The OsMAP3Kβ3 gene in the recombinant plasmid pENTER-TOPO Vector-OsMAP3Kβ3 constructed in Example 1 was recombined into the expression vector pH2GW7 (Gateway of Invitrogen Company) by LR reaction TW vector vector), the LR reaction system is 2 μl buffer, 2 μl (150-300ng) linearized pH2GW7 plasmid DNA, 2 μl (100-300ng) pENTER-TOPO Vector-OsMAP3Kβ3 plasmid DNA, 2 μl H 2 O, then add 2 μl LRClonase, the LR reaction condition is 25°C water bath for 1 hour, add 1 μl 2U / μl proteinase K, 37°C water bath for 10 minutes. Then, the above-mentioned recombinant vector was transformed into Escherichia coli (E.coli) DH5α competent cells by the heat shock method, positi...

Embodiment 3

[0064] Example 3, Genetic Analysis and Molecular Identification of Transgenic T1 Generation Rice Plants

[0065] The seeds of the OsMAP3Kβ3 T1 generation transgenic rice harvested in Example 2 were soaked in water for 3 days to allow them to germinate, and then 50 mg / L hygromycin was used for resistance selection, and at the same time, non-transgenic rice Zhonghua 11 was used as a control. After 5 days of selection, All the control plants died, counted the number of resistant seedlings and dead seedlings of the transgenic plants, analyzed the resistant segregation ratio of the transgenic plants, and selected lines with a segregation ratio of resistant seedlings and non-resistant seedlings of about 3:1, the results showed that OsMAP3Kβ3 transgenic lines with a single site insertion.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a cloned protein kinase gene of rice related to salt endurance and the application. The protein kinase gene codes a mitogen activating protein kinase (MAP3K), which is the following protein (i) or (ii): the amino acid sequence with SEQ ID NO: 1 in the sequence table; (ii) the protein derived from (i) with the function of controlling salt endurance of plants after replacing, missing or adding a to ten amino acid residues in the amino acid sequences limited by (i). The cloned protein kinase gene of rice related to salt endurance has the advantages that: the experiment proves that using the gene to transform the rice can significantly increase the salt endurance of rice without evidently influencing the normal growth and economic characters of the rice; the protein and the coding gene have important theoretical and practical significance to the improvement of salt endurance and related characters of the plant as well as the study on tolerance mechanism of the plant in adverse circumstances.

Description

technical field [0001] The invention relates to a plant salt tolerance related gene, in particular to a rice related protein kinase related gene and its application in cultivating salt tolerance plants. Background technique [0002] Protein kinases catalyze the phosphorylation of proteins in organisms, which is an important biochemical reaction in energy metabolism and signal transmission in organisms. Mitogen-activated protein kinases (MAPKs, mitogen-activated protein kinases) are a large family of protein kinases, belonging to the serine / threonine protein kinase family, with 11 conserved subdomains, widely present in various eukaryotes In biology (Nakagami H, Pitzschke A, Hirt H.2005.Emerging MAP kinase pathways in plant stress signaling.Trends Plant Sci.10:339~346), in response to various signals in cells, it rapidly activates in its serine, threonine Activated by phosphorylation of acid residues. MAPKs in eukaryotes play a pivotal role in the transfer of exogenous stim...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/12C12N15/54C12N15/82C12N15/65A01H1/00
Inventor王喜萍
OwnerBEIJING WEIMING KAITUO CROP DESIGN CENT COMPANYLIMITED