Broad host range plasmid carrying xylose metabolism related gene and construction method thereof

A technology of xylose metabolism and construction method, which is applied in the field of plasmid construction, can solve the problems of low raw material utilization rate and high production cost of cellulosic ethanol, and achieve the effect of shortening the experiment cycle and reducing production cost

Inactive Publication Date: 2009-07-08
TSINGHUA UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the utilization rate of raw materials is not high, resulting in high production costs of cellulosic ethanol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Broad host range plasmid carrying xylose metabolism related gene and construction method thereof
  • Broad host range plasmid carrying xylose metabolism related gene and construction method thereof
  • Broad host range plasmid carrying xylose metabolism related gene and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] Example 1 Construction of Entry Clones

[0082] 1.1 Construction of entry clone pENTRY221-L1-xylA-R5 containing xylose isomerase gene (xylA)

[0083] Amplify the attB1-xylA-attB5r fragment: E. coli DH5α (Invitrogen, Cat. No. 18263-012) was used as the source strain of the target gene, according to the sequence data on GeneBank (Accession Number: U00096) xylA gene corresponding to 3727444- 3728900 nucleotides, and attB1 and attB5r recombination fragments were introduced at both ends of the gene, and the primers were designed as follows:

[0084] Upstream primer attB1-xylA_for (57bp):

[0085] GTGAATTATCTCAATAG

[0086] attB1

[0087] CAGTGTGAA-3' (SEQ ID No: 2)

[0088] Downstream primer attB5r-xylA_rev (49bp):

[0089] CAACGGACTGCACAGTTAGCCG

[0090] attB5r

[0091] -3' (SEQ ID No: 3)

[0092] Using Taq DNA Polymerase (Sigma, Cat.No.D1806), the PCR reaction system is as follows:

[0093] 10×PCR Buffer 5.0μl

[0094] dNTP mix (10mM each)...

Embodiment 2

[0225] Example 2 Construction of pDEST14-ABAT plasmid

[0226] Use pDEST14 plasmid (Invitrogen) to carry out LR recombination reaction with the obtained 4 entry clones, see pDEST14-ABAT plasmid construction procedure figure 1 , dilute the 4 entry clones to about 10 fmoles / μl, the reaction system is as follows:

[0227] pENTRY221-L1-xylA-R5

[0228] pENTRY221-L5-xylB-L4 1.0μl each

[0229] pENTRY221-R4-talA-R3

[0230] pENTRY221-L3-tktA-L2

[0231] pDEST14 (20fmoles / μl) 1.0μl

[0232] 1×TEBuffer, pH 8.0 3.0 μl

[0233] LR Clonase TM Plus enzyme mix (Invitrogen, Cat. No. 12538-120) 2.0μl

[0234] Total Volume 10.0μl

[0235] After reacting at 25°C for 16 hours, add 1 μl of proteinase K (Invitrogen, Cat. No. 12537-104), and incubate at 37°C for 10 minutes.

[0236] Transformation E.coli One Shot Mach1 TM T1R competent cells (Invitrogen, Cat.No.C8620-03), coated with LB resistance plates containing 100mg / L ampicillin, picked positive clones, cultured and expanded wi...

Embodiment 3

[0237] Example 3 Construction of pBBR1MCS2-ABAT plasmid

[0238]The pDEST14-ABAT plasmid was double-digested with Xba I (Takara, Catalog No. D1093A) and Nhe I (Takara, Catalog No. Dll62A) (which is the same tail enzyme as Xba I and produces the same sticky end), and the pBBR1MCS2 plasmid was single-digested with Xba I. Enzyme cutting, the enzyme cutting system is as follows:

[0239]

[0240] The pBBRlMCS2 plasmid (Kovach et al 1995, presented by Dr. Wei Huang, University of Sheffield, see Image 6 ) was dephosphorylated with Xba I single-digestion product, pDFST14-ABAT plasmid was double-digested with Xba I and Nhe I to obtain a 7096bp ABAT fragment, and the two were carried out with QIAquick Gel Extraction Kits (QIAGEN, Cat.No.28706) Recovery and purification. The purified ABAT fragment and the vector pBBR1MCS2 were ligated with T4 DNA ligase (hkara, Cat.No.D2011A), and the ligation reaction system was as follows:

[0241]

[0242] Mix the above system evenly, centr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a wide host plasmid carrying xylose metabolism related genes and construction method thereof, belonging to the field of molecular biology techniques. The plasmid contains four xylose metabolism related enzyme genes, xylose isomerase (xylA), xylulokinase (xylB), transaldolase (talA) and transketolase (tktA), which are derived from E.coli DH5alpaha strain. The plasmid construction method uses the Gateway technology, to respectively design specific primers of four target genes xylA, xylB, talA and tktA, takes the E.coli DH5alpaha strain as the origin stain of the target genes to amplify the corresponding gene through the PCR; the PCR product performs BP recombination with the corresponding pDONR vector, and then the obtained Entry clones perform LR recombination with the pDEST14, to obtain the pDEST14-ABAT plasmid; the pDEST14-ABAT plasmid is connected to the Xha I single zyme cutting vector pBBR1MCS2 through the Xba I and Nhe I double zyme cutting product to obtained the recombinant plasmid pBBR1MCS2-ABAT. The superior strain shifted in the plasmid can greatly reduce production costs of cellulosic ethanol.

Description

technical field [0001] The invention belongs to the field of plasmid construction, and in particular relates to a broad host plasmid carrying genes related to xylose metabolism and a construction method of the plasmid. Background technique [0002] With the continuous consumption of oil resources, postage prices around the world have soared rapidly. In addition, the extensive use of fossil energy has caused serious impacts on the environment. All countries in the world have invested a lot of manpower, financial and material resources in the development of renewable biomass energy. Among them, ethanol has become one of the most promising alternative energy sources for petroleum because it can be produced from a variety of renewable raw materials and has little pollution to the environment. Ethanol can be produced from starchy and sugar-containing economic crops, or from lignocellulosic biomass through microbial fermentation. Lignocellulosic raw material is the raw material ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/63C12N15/61C12N15/54C12N1/21C12R1/19
Inventor李十中郑焕娣
OwnerTSINGHUA UNIV