Method for preparing recombinant human insulin and analogs of recombinant human insulin

A technology for recombining human insulin and analogues, applied in the field of genetic engineering, can solve problems such as harsh operating conditions, low proportion of proinsulin, and environmental pollution

Inactive Publication Date: 2009-09-02
AMTEK PHARMA
View PDF4 Cites 34 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the second method using the E. coli system can effectively increase the expression of fusion proinsulin to a certain extent, the proportion of proinsulin in the expression product is relatively low
The use of cyanogen bromide may cause greater pollution to the environment, and the operating conditions are harsh.
The present invention integrates the problems encountered in the expression and production of insulin at present, and provides a new type of human proinsulin or its analog molecules containing the N-terminal leader peptide sequence, and provides a proinsulin molecule using Escherichia coli high density The method of producing human proinsulin in a fermentation system can greatly increase the expression of proinsulin, and overcome the technical defect of using the toxic and harmful substance cyanogen bromide in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing recombinant human insulin and analogs of recombinant human insulin
  • Method for preparing recombinant human insulin and analogs of recombinant human insulin
  • Method for preparing recombinant human insulin and analogs of recombinant human insulin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1 Construction of MSR-proinsulin recombinant genetically engineered bacteria

[0050] 1.1 Acquisition of MS-proinsulin gene

[0051] Using pAmk as a template, design primers P1 and P2. The nucleotide sequences of the two primers are as follows:

[0052] P1: 5’GGAATTGTGAGCGGATAACA3’

[0053] P2: 5’AAAACGACTCATAACGTATTCCTCT3’

[0054] The fragment between the Asc I restriction site in pAmk and the expression guide peptide MS was amplified by PCR. Name it fragment-MS. Pfu DNA polymerase was used for amplification, and the amplification conditions were 94°C, 45s, 53°C, 45s, 72°C, and 30s. A total of 30 cycles. The PCR product was purified with a DNA gel recovery kit to recover a band of about 130 bp.

[0055] Design primers P3 and P4 with pET28a-23DT-proinsulin constructed in our laboratory:

[0056] P3: 5’ATGAGTCGTTTTGTCAATCAGCACC3’

[0057] P4: 5’CCGCCATGGCGCTTTTGATCC3’

[0058] Amplify the fragment between proinsulin and Nco I restriction site in pET28a-23DT-proinsul...

Embodiment 2

[0065] Example 2 Fermentation and expression of pAmk-MS-proinsulin recombinant genetic engineering bacteria

[0066] Pick a single colony from the culture plate of pAmk-MS-proinsulin recombinant genetically engineered bacteria, inoculate it in LB liquid medium containing 25μg / ml streptomycin, cultivate overnight at 37°C with constant temperature shaking, and transfer to inoculation at a ratio of 1% Into 20 liters of LB liquid medium (25 μg / ml streptomycin), and add a-lactose with a final concentration of 0.5 mmol / L to induce the expression of the fusion protein MS-proinsulin. Twelve hours after induction, the bacteria were recovered by centrifugation (5kg of wet bacteria in total), 15% SDS-PAGE electrophoresis followed by thin-layer scanning showed that the MS-proinsulin precursor proinsulin gene expression had been achieved, and the expressed protein accounted for the total bacterial protein. 44.2% of the total, see the results image 3 .

Embodiment 3

[0067] Example 3 Separation and purification of MS-proinsulin precursor proinsulin protein

[0068] The engineered bacteria after induced expression were recovered by centrifugation, and the bacteria were suspended in a lysis solution (pH 8.0, 50mM Tris-C1, 0.5% Triton X-100, 0.02% lysozyme) and stirred overnight at 37°C. The precipitate was recovered by centrifugation, and the precipitate was washed with inclusion body washing solution (pH8.0, 50mM Tris-C1, 0.2% Triton X-100), low-concentration urea solution (pH8.0, 50mM Tris-C1, 3M urea), and centrifuged after washing Recover the precipitate. The precipitate was lysed in high-concentration urea (pH 8.0, 50mM Tris-C1, 7M urea), and the supernatant was recovered by centrifugation. The supernatant was purified by sulfite hydrolysis (sodium sulfite, sodium tetrasulfate) and anion exchange (DEAE-52) chromatography. The chromatography buffer contains pH8.0, 50mM Tris-C1, 7M urea, and the gradient elution is performed with a 0-0.3M NaC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a molecule (Preproinsulin) of human proinsulin with a novel N-terminal expressed peptide sequence or analogs of the human proinsulin, a method for producing human insulin by using the molecule, and processes for building related expression vectors and engineering cells and expressing and purifying human proinsulin. The DNA sequence of the human proinsulin coded by the N-terminal expressed peptide sequence or the analogs of the human proinsulin is first introduced into a prokaryotic expression vector and then transferred into an escherichia coli to express the molecule in form of an inclusion body. The invention has the advantages that: the product has high expression amount and is easy to purify; the preparation method avoids the use of CNBr; and the process for processing the recombinant insulin is simple.

Description

Technical field [0001] The present invention relates to the technical field of genetic engineering. More specifically, the present invention provides a novel N-terminal leader peptide sequence of human proinsulin or its analogue molecule (Preproinsulin), and a method of using the molecule to produce human insulin, as well as related expression vectors and engineering cells. Construction, expression and purification process of human proinsulin. Background technique [0002] Diabetes is the third leading cause of death after cardiovascular and tumors. Today, there are 200 million diabetic patients in the world, and about 6 million new cases are added each year, and 3.2 million people die from diabetes and related complications each year (2006 Report of the American Diabetes Annual Meeting in June 2015). Insulin has been used to treat diabetes since the 1920s, and it is still an irreplaceable specific drug for diabetes, and the dose of insulin used in the treatment is mg. Each type ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/62C12N15/17C12N15/63C12N1/21C12P21/02C12R1/19
Inventor范豪刘景晶鲁勇刘素丽张笑岩杨亚男刘言华孔婧侯景
OwnerAMTEK PHARMA