Hepatitis B virus multi-drug resistant gene locus typing detection kit
A hepatitis B virus and gene locus technology, applied in the field of biotechnology detection, can solve problems such as cumbersome operation of detection technology, and achieve the effects of reducing the number of drugs, reducing pain and economic burden, and achieving reliable and stable results.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] The detection method steps of hepatitis B virus multi-drug resistance gene loci typing are as follows:
[0045] 1. Hepatitis B virus DNA extraction
[0046] Prepare 100 μL of serum containing hepatitis B virus, add 100 μL of concentrated solution, and centrifuge at 12,000 rpm for 10 minutes; discard the supernatant; add 25 μL of lysis buffer to mix, and lyse at 100°C for 10 minutes; finally, centrifuge at 12,000 rpm for 10 minutes, and the supernatant is the hepatitis B used sample.
[0047] 2. PCR reaction: the extracted DNA is amplified by PCR: the PCR primers used are two pairs of forward primers and reverse primers,
[0048] Forward primer 1 CTACCAGCACGGGACCATGC
[0049] Reverse primer 1 CAAGATGTTGTACAGACTTGG
[0050] Forward primer 2 GTCCCTTTTTTACCTCTATTACCA
[0051] Reverse primer 2 TACATGCATATAAAGGCATTGAGG
[0052] The components of the PCR system are shown in the table below:
Embodiment 2
[0066] Composition and preparation of reagents of hepatitis B virus multi-drug resistance gene loci typing detection kit
[0067] 1. Hepatitis B virus DNA extraction reagent, conventional method of concentration and cracking of hepatitis B virus.
[0068] 2. PCR reagents: see the table below
[0069] Reagent concentration sample system
µL ddH2O 9.1 9.1 11.1 polymerase buffer 10× 2 2 2 Mgcl2 50mM 2.4 2.4 2.4 dNTP 10mM 2 2 2 polymerase 2U / μL 0.5 0.5 0.5 case sample 10 3 -10 7 drops
Spend 2 (sample) 2 (plasmid)
Primer 2mM 2 2 2
[0070] PCR reaction program: denaturation and enzyme activation at 95°C for 15 minutes, denaturation at 94°C for 15 seconds, annealing at 50°C for 1 minute, extension at 72°C for 1 minute, and 35 cycles; finally, extension at 72°C for 5 minutes to fully amplify the reaction product. Primers used
[0071...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com