Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Hepatitis B virus multi-drug resistant gene locus typing detection kit

A hepatitis B virus and gene locus technology, applied in the field of biotechnology detection, can solve problems such as cumbersome operation of detection technology, and achieve the effects of reducing the number of drugs, reducing pain and economic burden, and achieving reliable and stable results.

Active Publication Date: 2009-09-30
上海翼和应用生物技术有限公司
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved by the present invention is to overcome the shortcomings of only single drug-resistant gene loci detection and cumbersome detection technology operation at present, and to provide a detection method for typing of multiple drug-resistant gene loci of hepatitis B virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hepatitis B virus multi-drug resistant gene locus typing detection kit
  • Hepatitis B virus multi-drug resistant gene locus typing detection kit
  • Hepatitis B virus multi-drug resistant gene locus typing detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] The detection method steps of hepatitis B virus multi-drug resistance gene loci typing are as follows:

[0045] 1. Hepatitis B virus DNA extraction

[0046] Prepare 100 μL of serum containing hepatitis B virus, add 100 μL of concentrated solution, and centrifuge at 12,000 rpm for 10 minutes; discard the supernatant; add 25 μL of lysis buffer to mix, and lyse at 100°C for 10 minutes; finally, centrifuge at 12,000 rpm for 10 minutes, and the supernatant is the hepatitis B used sample.

[0047] 2. PCR reaction: the extracted DNA is amplified by PCR: the PCR primers used are two pairs of forward primers and reverse primers,

[0048] Forward primer 1 CTACCAGCACGGGACCATGC

[0049] Reverse primer 1 CAAGATGTTGTACAGACTTGG

[0050] Forward primer 2 GTCCCTTTTTTACCTCTATTACCA

[0051] Reverse primer 2 TACATGCATATAAAGGCATTGAGG

[0052] The components of the PCR system are shown in the table below:

[0053] Reagent concentration System μL ddH2O 9.1 pol...

Embodiment 2

[0066] Composition and preparation of reagents of hepatitis B virus multi-drug resistance gene loci typing detection kit

[0067] 1. Hepatitis B virus DNA extraction reagent, conventional method of concentration and cracking of hepatitis B virus.

[0068] 2. PCR reagents: see the table below

[0069] Reagent concentration sample system

µL positive control

µL negative control

µL ddH2O 9.1 9.1 11.1 polymerase buffer 10× 2 2 2 Mgcl2 50mM 2.4 2.4 2.4 dNTP 10mM 2 2 2 polymerase 2U / μL 0.5 0.5 0.5 case sample 10 3 -10 7 drops

Spend 2 (sample) 2 (plasmid)

Primer 2mM 2 2 2

[0070] PCR reaction program: denaturation and enzyme activation at 95°C for 15 minutes, denaturation at 94°C for 15 seconds, annealing at 50°C for 1 minute, extension at 72°C for 1 minute, and 35 cycles; finally, extension at 72°C for 5 minutes to fully amplify the reaction product. Primers used

[0071...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a hepatitis B virus multi-drug resistant gene locus typing detection method and a kit thereof, wherein the detection method comprises the following steps that: DNA extraction is performed, wherein PCR amplification is applied to the abstracted DNA, the used PCR primers are two pairs of positive primers and negative primers; the PCR primers contain all correlative drug resistant locuses; amplified products of PCR are subjected to LDR amplification; the used probes are probes for correlation locus, which comprise a fluorescence labeling probe and a detection probe; a sequencing machine analyzes LDR products to judge the genotype of drug resistant locus; the multi-drug resistant gene locus is a drug resistant locus of lamivudine, ADV and ETV. The hepatitis B virus multi-drug resistant gene locus typing detection kit has reliable stable result, simple and quick operation; the kit can detect the drug resistant condition of various hepatitis B viruses, and supply clinical individuation medicine application instruction to hepatitis B virus patients. The kit can reduce the ineffectivity of drugs and administration times of the patients, thereby alleviating pains and economic burden of the patients.

Description

technical field [0001] The invention belongs to the field of biotechnology detection, and in particular relates to a detection method and a kit for typing the multi-drug resistance gene loci of hepatitis B virus. Background technique [0002] Chronic hepatitis B is one of the most serious health problems at present. About 2 billion people in the world have been infected with HBV. my country is a high-endemic area of ​​HBV infection. There are currently 130 million hepatitis B virus carriers in China, and more than 30 million hepatitis B patients . Hepatitis B virus is a highly mutated virus, which is induced by immune pressure and various antiviral drug treatments. Hepatitis B virus drug resistance means that under the action of nucleotide analogs, the drug target hepatitis B virus polymerase Some sites in the P gene of the (Pol) gene are changed, resulting in a decrease or disappearance of the inhibitory effect of the drug on the hepatitis B virus. [0003] Nucleotide anal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
Inventor 陆炯
Owner 上海翼和应用生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com