SCAR marks of genetic sterile multiple allele Ms of celery cabbage and application thereof
A technology of alleles and Chinese cabbage, applied in the field of characteristic sequence amplification markers, can solve the problems of inability to apply molecular markers to assisted breeding, complex detection methods, and long genetic distances
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1. Acquisition of the Amplified Fragment Length Polymorphism (AFLP) Marker Linked to the Chinese Cabbage Genic Sterility Multiple Allele Ms
[0045] 1. Construction of Separation Groups
[0046] When AB01-1(MsMs) was used as the female parent and S02(msms) was crossed, all the F1 plants obtained were sterile. Then use S02 as the reincarnation parent to build BC 1 generational segregation groups. All 244 strains of BC sown 1 Among the generation individuals, 130 were fertile and 114 were sterile. Fertility segregation ratio conforms to 1:1(x 2 =0.922;x 2 005,1 = 3.84).
[0047] 2. Extraction of DNA
[0048] a. Add 500uL 1×CTAB extract (2%CTAB, 100mmol / L Tris-HCl, 20mmol / LEDTA, 1.4mol / LNaCl,) and 6uL β-mercaptoethanol to a 1.5ml centrifuge tube, shake well;
[0049] b. Take 0.2 g of young leaves, grind them to powder under liquid nitrogen conditions, add them to a centrifuge tube containing CTAB extract and β-mercaptoethanol, and shake well;
[0050] c. Th...
Embodiment 2
[0067] Example 2. Acquisition and Identification of SCAR Markers Linked to Multiple Alleles of GMS in Chinese Cabbage
[0068] 1. Transformation of SCAR markers
[0069] The DNA fragments of P01 and P04 were purified with low-melting point agarose, the purified DNA fragments were connected with PGEM-T easyVector (Promega), transformed into Escherichia coli, and the recombinant plasmids were detected by electrophoresis, and the obtained positive clones were sent to Sangon for sequencing. Homology analysis was performed on the obtained sequencing results with the GenBank international gene database, and no related gene sequence was found to be highly homologous to this fragment. The sequences of the two SCAR markers are:
[0070] (1) SCR 01 -378:
[0071] 5’-GCAAATTTGTCAAACTTCACCCTTGTACGGAAAAATGTTTGCGGCTTGACGTGGCTCGAGTTTCTCCAGAAGCCACTGGTGGAGAGGATCAGCTTCGCGGATAAGGATGGTGTGCAAGTGGTGATTGATGTATGCTACCCCTGGTTGCCTCCGAGATGCAATATTTGCAATGCTTGGGGCCACAAGGGAGAGGCATGTAATTCGAGGAAGATTAAGGTTCT...
Embodiment 3
[0083]Example 3, the application of two SCAR markers in the assisted selection of the multiple allele Ms with GMMS in Chinese cabbage
[0084] (1) Carry out the extraction of genomic DNA by the method in embodiment 1 to be tested material
[0085] (2) PCR amplification:
[0086] a. Reaction system: 25uL system, the content of each component is 20ng template; 2.5uL 10×Buffer; 1.6mM MgCl 2 ; 0.15mmol / L dNTP; 5pmol primer; 1.25U Tag DNA polymerase; ddH 2 O make up 25uL, mix well, and centrifuge;
[0087] b. Amplification program: pre-denaturation at 94°C / 4min, 94°C / 60s, 59°C / 60s, 72°C / 90s, after 30 cycles, extension at 72°C for 10 minutes;
[0088] c. Electrophoresis:
[0089] ①SCR 01 -378: Take 10uL of the amplification product and mix it with 2uL of 6×Loading buffer, point it into 1.5% agarose gel containing 0.5ug / ml EB, electrophoresis at 110V for 1 hour, and image it on the gel after staining with EB Observe and take pictures in the instrument.
[0090] ②SCR 02 -208: ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com