Unlock instant, AI-driven research and patent intelligence for your innovation.

H5N1 derived avian influenza virus NP resistant monoclonal antibody and application thereof

An avian influenza virus and monoclonal antibody technology, applied in the field of immunology, can solve the problems of dangerous operation, prone to contamination and infection, and high cost

Inactive Publication Date: 2011-10-26
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These diagnostic methods are limited to laboratory diagnosis, and have the following disadvantages: (1) dangerous operation, prone to contamination and infection, and can only be operated by professionals in professional laboratories; (3) The instruments are complicated, the cost is high, and professionals are needed to analyze the results and data and make a diagnosis report; this is extremely inconvenient for disease diagnosis and case screening
There are only a few products on the market that can specifically diagnose and distinguish types A, B, and C, and their quality and stability are not reliable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • H5N1 derived avian influenza virus NP resistant monoclonal antibody and application thereof
  • H5N1 derived avian influenza virus NP resistant monoclonal antibody and application thereof
  • H5N1 derived avian influenza virus NP resistant monoclonal antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0077] As an embodiment of the present invention, the monoclonal antibody can be prepared by the following preparation method, which includes the steps of: (1) providing adjuvant pretreated mice; (2) intraperitoneally inoculating the mice The hybridoma cells secrete monoclonal antibodies; (3) ascitic fluid is extracted, and the monoclonal antibodies are obtained by separation. As a way, the method of isolating monoclonal antibody from ascites is: collect ascites, precipitate with ammonium sulfate and octanoic acid, and then purify with Protein G prepacked chromatography column to obtain high-purity anti-NP monoclonal antibody.

[0078] In addition, the hybridoma cells can also be cultured and expanded in vitro according to conventional animal cell culture methods, so as to secrete the monoclonal antibody.

[0079] After obtaining the anti-NP monoclonal antibody of the present invention, those skilled in the art can sensitively detect the NP protein and its concentration in the...

Embodiment 1

[0128] Embodiment 1: the prokaryotic expression of NP protein

[0129]The inventor obtained a recombinant pGEM-T-vector vector containing the target gene fragment (obtained from Shanghai Yingmu Biotechnology Co., Ltd.), using the vector as a template to

[0130] CGCGGATCCATGGCGTCTCAAGGC (SEQ ID NO: 3); and

[0131] CCGCTCGAGTTTAATTGTCATACTC (SEQ ID NO: 4)

[0132] As a primer, the target gene encoding NP protein was obtained by PCR amplification. The obtained gene was verified to be free of mutations by sequencing.

[0133] By adding primers with BamH I and Xho I restriction sites at both ends, the cloned gene was connected to the PGEX-4t-1 vector (purchased from Novagen) to obtain the PGEX-4t-1-NP recombinant plasmid. Then the recombinant plasmid was transformed into Rossetta expressing Escherichia coli, induced under the condition of 0.5mM IPTG, and the expressed protein mainly existed in the supernatant.

[0134] The NP protein expressed in the supernatant was purified ...

Embodiment 2

[0140] Example 2: Animal immunization

[0141] Mice were immunized with the NP-GST fusion protein purified in Example 1. Balb / c mouse immunization dose: 0.1 mg each time. Multiple intramuscular injections. Immunization program: 0, 3, 6 weeks for three immunizations. Three days before fusion, 0.1 mg of protein was injected intraperitoneally for memory stimulation. Take mouse antiserum to obtain mouse anti-NP polyclonal antibody.

[0142] Male New Zealand white rabbits were immunized with the purified NP protein in Example 1. Dosage: 1mg each time. Subcutaneous injection at multiple points in vivo. Immunization program: 0, 3, 6 weeks 3 immunizations. Take antiserum and obtain rabbit anti-NP polyclonal antibody.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a specific avian influenza virus NP resistant monoclonal antibody which is derived from a hybridoma cell strain with a China Center for Type Culture Collection (CCTCC) NO: C200810, a CCTCC NO: C200811 or a CCTCC NO: C200812. The monoclonal antibody has high specificity and sensitivity. The invention also discloses a kit for detecting avian influenza viruses.

Description

technical field [0001] The invention belongs to the field of immunology, and more specifically, the invention relates to a monoclonal antibody against nucleoprotein NP of avian influenza virus derived from H5N1 and application thereof. Background technique [0002] Influenza is generally characterized by high pathogenicity, high infectivity, rapid spread, and high mortality. Its diagnosis is mainly for poultry and humans. Generally, there are clinical, epidemiological diagnosis, pathological and etiological diagnosis, serological diagnosis and other detection techniques. The bed symptoms of avian influenza are inconsistent due to the different types, ages, concurrent infections, and virulence of newly infected strains of infected birds. The pathological changes are different due to the level of virulence of the infected virus strains, the length of the course of the disease, and the types, and there are no characteristic traits and autopsy changes. Therefore, the diagnosis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/10C12N15/13C12N5/18G01N33/577
Inventor 孙兵董庆犀季永镛唐琳娜
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com