Check patentability & draft patents in minutes with Patsnap Eureka AI!

Rice dwarf-related protein and coding gene and application thereof

A technology encoding genes and proteins, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of dwarf stalk and flower organ developmental delay, and achieve the effects of enriching the dwarf rice source, shortening the breeding period and improving the breeding efficiency.

Active Publication Date: 2009-12-23
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, four GA2 oxidase genes have been cloned in rice (0sGA2ox1, 0sGA2ox2, 0sGA2ox3, 0sGA2ox4), and the four genes have different expression patterns in rice, and the overexpression of 0sGA2 oxidase 1 also causes rice plants Dwarf stalk and stunted flower organ development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice dwarf-related protein and coding gene and application thereof
  • Rice dwarf-related protein and coding gene and application thereof
  • Rice dwarf-related protein and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1, the acquisition of rice OsGA20X5 gene

[0041] a) Obtaining and genetic analysis of rice dominant dwarf mutant DD1

[0042] The wild type Wuxiangjing 9983 was provided by Jiangsu Tomorrow Seed Industry Co., Ltd.

[0043] In the transgenic T with japonica rice variety Wuxiangjing 9983 0 A dwarf mutant, numbered GN42, was screened from the generation plants, and T 0 generation seed, T 0 T 1 Generation plants, observe and record T 1 The phenotype and segregation ratio of the generation plants. The results showed that mutant T 1 Generation from the tillering stage showed a height separation of 1:3, and the dwarf trait was co-segregated with the transgenic resistance selectable marker gene hygromycin gene, which indicated that the dwarf trait was heritable. to T 2 generation plants for further genetic analysis, T 2 The ratio of tall stem plants to dwarf stem plants in the generation plants was still 1:3, which was consistent with the genetic performanc...

Embodiment 2

[0069] Embodiment 2, the acquisition of rice overexpressing the OsGA20X5 gene

[0070] a) Construction of pCAMBIA-0sGA20X5 expression vector

[0071] Using the cDNA of wild-type Wuxiangjaponica 9983 as a template, the following primers P1 and P2 were designed to amplify the fragment of the coding region of the OsGA20X5 gene. The sequences of the primers P1 and P2 are as follows:

[0072] P1: A GGATCC ATGCCGGCCTTCGCCGACAT;

[0073] P2: G GAGCTC TTATTGTACTGAAGAATGCT.

[0074] Recognition sites for BamH I and Sac I enzymes were introduced at both ends of primers P1 and P2, respectively.

[0075] The amplified product was purified with the QIAquick Gel Recovery Kit (Qiagen, 28706) according to the product instructions, and then ligated with the pGEM-T EASY vector (Promega, A1360) at 16°C for 8 hours to construct the recombinant vector pGEM-OsGA20X5. Using a 2mm electrode cup, the recombinant vector pGEM-0sGA20X5 was transformed into Escherichia coli DH5α at 2500V, and the trans...

Embodiment 3

[0088] Example 3 Tissue expression characteristics of rice OsGA20x5 gene

[0089] The expression characteristics of OsGA20x5 gene in different tissues were detected by RNA Northern hybridization method. The total RNA of the coleoptile, root, seedling, leaf, inverted stem, lower stem and ear was extracted respectively, and Northern hybridization analysis was carried out according to the method described in the third edition of "Molecular Cloning".

[0090] Experimental results such as image 3 As shown, in addition to not expressing in roots, other tissues including leaf sheaths, coleoptiles, leaves, panicle stems, inverted stems, and ears are all expressed. The expression in ears is the strongest, followed by stems, and leaves, sheaths, and germs The expression level in the sheath was similar, indicating that the expression of OsGA20x5 gene is closely related to the growth and development of rice.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice dwarf-related protein and a coding gene and application thereof. The protein is protein (a) or (b): protein (a) is formed by an amino acid sequence shown as a sequence 3 of a sequence list; and protein (b) is formed by substituting and / or lacking and / or adding one or more amino acids in the amino acid sequence shown as the sequence 3 of the sequence list, related to rice dwarf and derived from the protein (a). The invention also provides the gene for coding the protein and a recombinant expression vector containing the gene, a transgenic cell system or recombinant bacteria. The gene is utilized to breed rice with reduced strain height. The rice dwarf-related protein and the coding gene have extremely important values of shortening the breeding period, improving the breeding efficiency and enriching rice dwarf sources.

Description

technical field [0001] The invention relates to a rice dwarf-related protein and its coding gene and application. Background technique [0002] Gibberellin (Gibberellin, GA) is the first phytohormone discovered, which is a class of tetracyclic diterpene carboxylic acid compounds. So far, 126 gibberellins have been found in plants and fungi, but only a few GAs (GA1, GA4, GA3 and GA7) have physiological activity. GA is an important class of plant hormones, involved in various processes of plant growth and development such as seed germination, stem elongation, leaf growth, pollen maturation and flower induction and development. The dwarfing of plants is an important feature of plants, because of its strong lodging resistance, and dwarf plants can reduce vegetative growth, transport more photosynthetic products to reproductive organs, and increase yield. Therefore, dwarf crops are often selected for use in breeding. By introducing dwarf genes into wheat and rice crops, new var...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N15/11C12N5/10C12N1/15C12N1/19C12N1/21C12N15/82A01H1/00A01H5/00
Inventor 程祝宽黄健李明唐丁
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More